ID: 1021360705

View in Genome Browser
Species Human (GRCh38)
Location 7:19708846-19708868
Sequence GATGTGCCTTTGGTGCGGCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 70}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021360698_1021360705 15 Left 1021360698 7:19708808-19708830 CCGGTGCGTTTCCTGTTAAGGTA 0: 1
1: 0
2: 1
3: 3
4: 53
Right 1021360705 7:19708846-19708868 GATGTGCCTTTGGTGCGGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 70
1021360702_1021360705 4 Left 1021360702 7:19708819-19708841 CCTGTTAAGGTAGCGGGGCGACA 0: 1
1: 0
2: 0
3: 2
4: 12
Right 1021360705 7:19708846-19708868 GATGTGCCTTTGGTGCGGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021360705 Original CRISPR GATGTGCCTTTGGTGCGGCC CGG Exonic
906114711 1:43349014-43349036 TGTGCGGCTTTGGTGCGGCCGGG - Intronic
915458465 1:156055174-156055196 GATGTGCCCTTGGTGGGACTTGG + Intronic
1063254913 10:4316668-4316690 GAAGTGCCCTTGGTTCTGCCAGG - Intergenic
1063257030 10:4339899-4339921 GATGTGCCTTGGGTCAGGTCTGG - Intergenic
1069543702 10:69314371-69314393 TAGGTGGCTTTGGTGCAGCCAGG + Intronic
1073476630 10:103757866-103757888 GCTGTGCCTGGGCTGCGGCCTGG + Intronic
1075209650 10:120480321-120480343 GATGTGCATCTGGTGCAGGCTGG + Intronic
1076015977 10:127027970-127027992 GATGTGTGTGTGGTGGGGCCCGG + Intronic
1076633852 10:131870065-131870087 AAAGTGCCTTTGGCGGGGCCAGG + Intergenic
1077188875 11:1247468-1247490 GAGGTGCCCCTGGTGTGGCCCGG - Exonic
1078250495 11:9613319-9613341 GATGTTCCTTTGGCGCTGCTGGG - Intergenic
1080599777 11:33810078-33810100 GATGTGCCTGTGTGGTGGCCAGG - Intergenic
1080678188 11:34447228-34447250 GAAGTGCCCTGGGTGAGGCCTGG - Intronic
1083704729 11:64506067-64506089 CAGGGGGCTTTGGTGCGGCCAGG - Intergenic
1084003560 11:66311963-66311985 GATGGGCCTTTGGCGCCACCTGG - Intergenic
1084996442 11:72984129-72984151 GATGTGCATTTGCTGCCGCTAGG + Exonic
1085558612 11:77449167-77449189 GATGGGCCTTTGGTGCAACCAGG + Intronic
1089149943 11:116356885-116356907 GCTGTGCCTTTTCTGGGGCCAGG - Intergenic
1097031440 12:56093004-56093026 GTTGTGCATGTGGGGCGGCCAGG - Exonic
1113957456 13:114106990-114107012 GATGTGGCTCTGGGGGGGCCTGG - Intronic
1118699053 14:68415075-68415097 GATGAGCCTTAAGTGCAGCCAGG - Intronic
1119552793 14:75527563-75527585 GATGTCTCTTTGCTGCGGCAAGG + Intronic
1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG + Exonic
1122630253 14:103104378-103104400 GACGTCCATATGGTGCGGCCCGG + Exonic
1122887109 14:104714963-104714985 GAGGTGACTTGGGTGCGGCACGG + Intronic
1132145885 15:99429728-99429750 CATGTGGCTTTGGTGGGGACAGG + Intergenic
1132364563 15:101247832-101247854 GCTGTGCCTTTAGTGTGGACGGG + Intronic
1149039845 17:52174764-52174786 CATGTACCTTTGGTGGGGCCTGG + Intergenic
1161576665 19:5058298-5058320 GAAGGGCTTTTGGTGTGGCCGGG + Intronic
1166128100 19:40728536-40728558 GATTTGCTTTTGCTGCTGCCTGG - Intronic
1168185260 19:54696369-54696391 GATGAGCCGTTGGTGCTGGCAGG - Intronic
925170786 2:1749183-1749205 CATGTGCCTTTGGGTCTGCCTGG + Intergenic
938554609 2:132413746-132413768 AATGTGCTTTTGGTGCGTCTGGG + Intergenic
940224174 2:151384416-151384438 GATGGGCCCTTTGTGCTGCCTGG - Intergenic
943770690 2:191713178-191713200 GCTATCCCTTTGGTGGGGCCTGG + Intergenic
945813193 2:214572891-214572913 GAAGTGCCTTTGGTTAGGCCTGG + Intronic
948399613 2:237674136-237674158 GAGGTGCCTTTGGGGCTTCCAGG + Intronic
1170723678 20:18906219-18906241 GATGTGCCTCAGGTGCAGCCTGG + Intergenic
1173506485 20:43591082-43591104 GCTGGGGCGTTGGTGCGGCCTGG + Intronic
1174378566 20:50141949-50141971 GCTGTGCCCTTGGTCCTGCCTGG - Intronic
1178680162 21:34667977-34667999 GGTGTGCCTTTGATGTGGCTTGG - Intergenic
950258261 3:11523567-11523589 GATTTGCCTTTGGGAGGGCCAGG + Intronic
953406821 3:42663871-42663893 CATGTGCCAATGGTGCGGCAAGG + Exonic
953709322 3:45256931-45256953 GATATCCCTTCGGTGAGGCCGGG + Intergenic
953709750 3:45260067-45260089 GATGGCCTTTTGGTGCTGCCAGG - Intergenic
956809207 3:72848161-72848183 AATGCGCCTTTCCTGCGGCCAGG + Intronic
960435153 3:117617533-117617555 CATGTGTGTTTGGTGAGGCCTGG + Intergenic
960970335 3:123134882-123134904 GGTGTGTCTGTGGTGCTGCCTGG + Intronic
962266498 3:133948088-133948110 GAGGAGCCTCTGGTGCAGCCTGG + Intronic
968746752 4:2364379-2364401 GCTGTGCCCTTGGGGCGGGCAGG - Intronic
977990108 4:103431492-103431514 GCTGTGCCTTTGTAGCTGCCTGG - Intergenic
984014215 4:174406740-174406762 GATGTGCATTTGGTGAAGACTGG + Intergenic
992095558 5:73359357-73359379 GATAGGCCTTTAGTGCTGCCTGG + Intergenic
995874783 5:116778865-116778887 GATGTGTCTTTTATGCAGCCTGG + Intergenic
998958818 5:147463909-147463931 GATTTGCCTTTGCTGCTGCTAGG + Intronic
1001220225 5:169894332-169894354 GAGGTGCCTTGGGTGGGGGCTGG + Intronic
1001854845 5:175002076-175002098 AATTTGCCTTTGTTCCGGCCTGG - Intergenic
1015838023 6:137443776-137443798 GATGTGTCTATGGTGTGGCTGGG + Intergenic
1021360705 7:19708846-19708868 GATGTGCCTTTGGTGCGGCCCGG + Exonic
1029419852 7:100466920-100466942 AATGTGCCTTTGGGGCTGCCCGG - Exonic
1041369471 8:57143504-57143526 GAGCTGCCTTTGGTGCGCACGGG + Intergenic
1041461707 8:58118788-58118810 GATGTTATTTTGGTGCAGCCTGG + Intronic
1042203865 8:66308571-66308593 GATATGCCATTGCTGCTGCCAGG + Intergenic
1048425301 8:134317979-134318001 GATGGGCCTTTGCTGTGGCAGGG - Intergenic
1053280935 9:36819534-36819556 GAGGTGCCTGGGGTGCGTCCAGG + Intergenic
1053308599 9:37001342-37001364 GATGTGCCTAAGCTGGGGCCTGG - Intronic
1056603495 9:88065547-88065569 CATGGGTCTTTGGTGCGGTCTGG + Intergenic
1057997799 9:99835499-99835521 GAACTGCCTTTGGAGAGGCCAGG - Intronic
1060584463 9:124777416-124777438 GCTGTGGCTGGGGTGCGGCCCGG + Intronic
1060872491 9:127054014-127054036 GAGTTGCCTTGGGTGCCGCCAGG + Intronic
1062305916 9:135907186-135907208 GCGGCGCCTTTGTTGCGGCCGGG - Exonic
1062338252 9:136081986-136082008 GATTGGCCTTTGCTGCAGCCTGG - Intronic
1186778293 X:12887939-12887961 GATGTGACTTGTGTGGGGCCAGG + Exonic
1191033153 X:55997115-55997137 GAAGTGCCCCTGGTGCAGCCAGG + Intergenic
1192246368 X:69375101-69375123 GATGGGCATTTGGAGCTGCCTGG - Intergenic
1199278030 X:145969493-145969515 GAGGTGACTTTGGTGCTGCTGGG + Intergenic