ID: 1021360774

View in Genome Browser
Species Human (GRCh38)
Location 7:19709268-19709290
Sequence GTTTTCGCACAGAGGCTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 64}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021360769_1021360774 13 Left 1021360769 7:19709232-19709254 CCAACCGACTGCTCTTTTAAGGG 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1021360774 7:19709268-19709290 GTTTTCGCACAGAGGCTTATTGG 0: 1
1: 0
2: 1
3: 1
4: 64
1021360771_1021360774 9 Left 1021360771 7:19709236-19709258 CCGACTGCTCTTTTAAGGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1021360774 7:19709268-19709290 GTTTTCGCACAGAGGCTTATTGG 0: 1
1: 0
2: 1
3: 1
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021360774 Original CRISPR GTTTTCGCACAGAGGCTTAT TGG Intergenic
900717359 1:4153470-4153492 GTTATCGCACAGCTGCTCATGGG + Intergenic
906535814 1:46550441-46550463 GTTCTGGCACAGATGCTCATCGG - Intronic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
920142091 1:203823667-203823689 TTTTCTGCACTGAGGCTTATTGG + Intronic
1068233766 10:54205207-54205229 CTTCTCTCACACAGGCTTATAGG + Intronic
1072435779 10:95413837-95413859 GTTTTGTCACAGAGGCTCCTGGG + Intronic
1076066794 10:127455165-127455187 GTTTGGGTACAAAGGCTTATTGG - Intergenic
1083940612 11:65893444-65893466 ATTTTCTCCCAGGGGCTTATGGG - Intronic
1095096643 12:38152776-38152798 GTTCTGGCACAGAGGCTGCTGGG - Intergenic
1104390173 12:128385240-128385262 GTCCTCGCACAGAGCCTGATAGG + Intronic
1104390177 12:128385295-128385317 GTCCTCGCACAGAGCCTGATAGG + Intronic
1104390181 12:128385350-128385372 GTCCTCGCACAGAGCCTGATAGG + Intronic
1104390185 12:128385405-128385427 GTCCTCGCACAGAGCCTGATAGG + Intronic
1106916079 13:34515681-34515703 GATTTCCCACAGAGGCTGAATGG - Intergenic
1110070899 13:71176054-71176076 GTTCTCACACAGAAACTTATAGG + Intergenic
1123994246 15:25707081-25707103 GTTTGCCCACAGAATCTTATAGG - Intronic
1126402798 15:48291644-48291666 GCTTTCAGACAGAGGCTTTTTGG - Intronic
1128211646 15:65907606-65907628 GTTTTTTCTGAGAGGCTTATAGG + Intronic
1128741492 15:70087007-70087029 GTTTTCTGACAGAGGCCTGTAGG - Intronic
1130871725 15:87977412-87977434 GTGTTTCCACAGAGACTTATAGG - Intronic
1133513978 16:6489304-6489326 GGTTTGGCACATAGGTTTATTGG + Intronic
1133972647 16:10578795-10578817 GTTTTCCCACTGAGGGTTTTTGG - Intronic
1135943292 16:26841555-26841577 TTTTTCACTCAGAGGCATATAGG + Intergenic
1149037141 17:52147554-52147576 GTTTTAGCACTGAGTTTTATTGG - Intronic
1153077709 18:1184237-1184259 GTTTTAGCAAAGAGGCTTCAAGG - Intergenic
1155346391 18:24861528-24861550 CTTTTGGCACAGAGGCCTAGAGG + Intergenic
1156374062 18:36496493-36496515 GTTTAGGCAGAGAGGCTTTTTGG + Intronic
1157351231 18:46888263-46888285 CTTTTCCCACATAGGCTGATGGG - Intronic
1160000609 18:75017448-75017470 GTTTTGGCAGGGAGGTTTATAGG + Intronic
1165080779 19:33304754-33304776 GTTGTCACACAGAGGCTGCTGGG + Intergenic
931240974 2:60452450-60452472 GTCTTCGCACAACGGCTTCTTGG + Intronic
934979745 2:98829921-98829943 GTTTTGGCTCAGAGGGTTTTGGG - Intronic
939287778 2:140154855-140154877 GTTTTAGCAAAGAGACTTGTGGG - Intergenic
944818379 2:203403404-203403426 GTGTTCACACATAGGCTTACTGG - Intronic
1181864451 22:25844335-25844357 CTTTTAGTTCAGAGGCTTATTGG + Intronic
950126960 3:10515564-10515586 GTTTTCAGGCAGAGGCTGATGGG - Intronic
952092824 3:29910991-29911013 GTTTTCTGACAGAGTCTTATTGG - Intronic
957497129 3:81007035-81007057 GTTTTCTCACAGAGGTCTGTGGG - Intergenic
961222903 3:125213547-125213569 ATTTTCACACAAAGGCTTGTGGG - Intergenic
962747633 3:138409113-138409135 GTTTTCACACAGAGGCAAGTGGG + Intergenic
978702463 4:111664583-111664605 GTTTACACACAAAGGCTTTTTGG - Intergenic
990185415 5:53205093-53205115 GTGTTCACACAGAAGCGTATAGG - Intergenic
990855572 5:60263093-60263115 GCGTTAGCACAGAGGTTTATAGG - Intronic
994013813 5:94941419-94941441 GTTTGAGCACAATGGCTTATTGG - Intronic
1003624342 6:7728076-7728098 GTTTTCCCACCGAGACTTTTAGG + Intronic
1006275591 6:33002750-33002772 TTTTTCTCTCAGAAGCTTATAGG - Intergenic
1008435801 6:51474660-51474682 GCTTTAGCAAAGAGGCTTTTGGG + Intergenic
1012560475 6:100574249-100574271 GCTTTGGCACAGAAGTTTATGGG + Intronic
1015597788 6:134882100-134882122 GTTTTCGGAGAGTGGCTTCTTGG + Intergenic
1021360774 7:19709268-19709290 GTTTTCGCACAGAGGCTTATTGG + Intergenic
1021477543 7:21079807-21079829 GATTTGGCAGAGAGGCTTCTGGG + Intergenic
1022019261 7:26382584-26382606 GTTTTCACACAGTGGCTTTGGGG - Intergenic
1029268944 7:99364916-99364938 GTTTTCACACAGAGGAATCTAGG + Intronic
1034142112 7:148830021-148830043 GTTTTCTCAGATATGCTTATTGG - Intronic
1034963482 7:155376859-155376881 GTTTTGGTACAGAGGCTTATAGG - Intergenic
1049605961 8:143529319-143529341 GTTTGGCCACAGATGCTTATGGG - Intronic
1050593131 9:7180377-7180399 GGTTCCGGACAGAGGCTTCTGGG - Intergenic
1055629089 9:78204650-78204672 ATTTTTGCACTGATGCTTATCGG - Intergenic
1186137837 X:6538133-6538155 GTTGTCTCACATAGCCTTATTGG + Intergenic
1193746069 X:85282812-85282834 GTTTTCACCCAAAGGCTTTTGGG - Intronic
1194121195 X:89965801-89965823 GATTTCTCACAGAGCCTTAGCGG - Intergenic
1194468812 X:94267002-94267024 GTCTTGGCACAAAGGCTTCTAGG + Intergenic
1195309414 X:103616305-103616327 GTTTTCCCACAGAGGGCTTTGGG - Intronic
1199079408 X:143559591-143559613 GTTTTCCCACAGACACTTTTAGG - Intergenic
1201309850 Y:12587114-12587136 GCTTTTGCATAGAGGCTTTTGGG + Intergenic
1201764674 Y:17566096-17566118 GTTCTGGCACAGAGGCTGCTGGG + Intergenic
1201836879 Y:18339894-18339916 GTTCTGGCACAGAGGCTGCTGGG - Intergenic