ID: 1021361537

View in Genome Browser
Species Human (GRCh38)
Location 7:19718993-19719015
Sequence TATGGTAGGACAGAGACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021361537_1021361540 26 Left 1021361537 7:19718993-19719015 CCTGCAGTCTCTGTCCTACCATA No data
Right 1021361540 7:19719042-19719064 TCTTATTTTCTCTTGCCCTCAGG No data
1021361537_1021361541 27 Left 1021361537 7:19718993-19719015 CCTGCAGTCTCTGTCCTACCATA No data
Right 1021361541 7:19719043-19719065 CTTATTTTCTCTTGCCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021361537 Original CRISPR TATGGTAGGACAGAGACTGC AGG (reversed) Intergenic
No off target data available for this crispr