ID: 1021362210

View in Genome Browser
Species Human (GRCh38)
Location 7:19729578-19729600
Sequence ATCTCATTCTAGAATAGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 247}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021362208_1021362210 1 Left 1021362208 7:19729554-19729576 CCTTCAAAACCTGGAGAGGATAA 0: 1
1: 1
2: 2
3: 21
4: 281
Right 1021362210 7:19729578-19729600 ATCTCATTCTAGAATAGTAAAGG 0: 1
1: 0
2: 2
3: 34
4: 247
1021362205_1021362210 28 Left 1021362205 7:19729527-19729549 CCAGGGAAGATAGAACATTTTAA 0: 1
1: 0
2: 2
3: 39
4: 296
Right 1021362210 7:19729578-19729600 ATCTCATTCTAGAATAGTAAAGG 0: 1
1: 0
2: 2
3: 34
4: 247
1021362209_1021362210 -8 Left 1021362209 7:19729563-19729585 CCTGGAGAGGATAAGATCTCATT 0: 1
1: 2
2: 9
3: 257
4: 2834
Right 1021362210 7:19729578-19729600 ATCTCATTCTAGAATAGTAAAGG 0: 1
1: 0
2: 2
3: 34
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021362210 Original CRISPR ATCTCATTCTAGAATAGTAA AGG Intronic
900901762 1:5521564-5521586 AAAACATTCTAGGATAGTAAAGG + Intergenic
902452709 1:16507825-16507847 ATCTGATTCTACAAGAGTAAGGG - Intergenic
902472769 1:16660489-16660511 ATCTGATTCTACAAGAGTAAGGG - Intergenic
902486035 1:16746954-16746976 ATCTGATTCTACAAGAGTAAGGG + Intronic
902499774 1:16902390-16902412 ATCTGATTCTAGAAGAGTAAGGG + Intronic
905479184 1:38249546-38249568 ATCTTATGCTAGAAGAGAAATGG + Intergenic
907928197 1:58974332-58974354 AACTCATTCAAGACTAGCAATGG - Intergenic
909018314 1:70403812-70403834 AGCTCCTTCCATAATAGTAAAGG - Intergenic
909155132 1:72064681-72064703 TTCTCATTCTAGATGATTAATGG - Intronic
909460372 1:75905783-75905805 ATGTTATTCTATAATAATAAAGG - Intronic
909996946 1:82291529-82291551 ATCTCATTCAAGAATATAAATGG + Intergenic
910358263 1:86387590-86387612 AACTCAATCTAGAATATTATTGG + Intronic
911656424 1:100449137-100449159 ATCACTTTCTAGAATAGAAATGG - Intronic
915888134 1:159745211-159745233 ATGTCATTCTGGAACAGAAAAGG + Intergenic
917376434 1:174352912-174352934 ATCTCTTTGGAGAAGAGTAAAGG - Intronic
917410435 1:174754981-174755003 ATTTATTTGTAGAATAGTAATGG + Intronic
918246482 1:182664413-182664435 TCCTCATTCTAAAATAGTGATGG - Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919458246 1:197845791-197845813 GTGTCATTCTAGAACAGTAAGGG - Intergenic
920852217 1:209635812-209635834 ATTTCGTTCCAGAATAGTATTGG - Intronic
921012271 1:211153947-211153969 ATGTCATTATATAATAATAAAGG + Intergenic
922427349 1:225511167-225511189 ATTTCATTCCAGAATAGATAAGG + Intronic
1063513563 10:6671408-6671430 ATCTCAGTCTAAAATGGGAAGGG + Intergenic
1065426688 10:25613015-25613037 ATGTCATTACATAATAGTAAAGG - Intergenic
1068025515 10:51638263-51638285 ATCTCATCTTAAAATAGTAATGG + Intronic
1068642953 10:59431719-59431741 CACTCAATCTAGAAAAGTAAGGG - Intergenic
1069235257 10:66063499-66063521 ATCTCTCTCTAAAAGAGTAAAGG - Intronic
1074092473 10:110274496-110274518 AACTCATGCTAAAATAGGAAAGG + Intronic
1074340521 10:112624266-112624288 ATTTCATTCTAGACTAATCATGG - Intronic
1074492360 10:113950005-113950027 ATGTCTTTCTAGAACTGTAAAGG + Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1079512113 11:21223297-21223319 ATCTCATTATATAATGATAAGGG - Intronic
1079850291 11:25524821-25524843 AGCTCATTCTAGAGTAGGATGGG - Intergenic
1080526104 11:33121065-33121087 TTTTCATTCAAGAAAAGTAATGG - Intronic
1081069887 11:38597475-38597497 AACTCCTTTTAGAATATTAAGGG - Intergenic
1081161381 11:39754329-39754351 GTCTCATGATAGAACAGTAATGG - Intergenic
1081490014 11:43560000-43560022 ATCTCTCTCTAGAATCGTCATGG + Intronic
1082638495 11:55626348-55626370 AGGGCATTCTATAATAGTAAAGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1086035841 11:82413365-82413387 AAGTCATTATATAATAGTAAAGG + Intergenic
1086284299 11:85228017-85228039 ATCTCATTGAGGAGTAGTAAAGG - Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1088536245 11:110865339-110865361 ATCTCCTTCTAAAAGAATAAGGG - Intergenic
1088577426 11:111285454-111285476 ATCTAATTCTAGAGTAGGAAGGG + Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1093733860 12:22596068-22596090 ATCTCGATCAAGAAAAGTAATGG - Intergenic
1094096805 12:26714566-26714588 ATTTCATTTTAGAATATTAAAGG + Intronic
1096830268 12:54308358-54308380 ATATCATCCTATAATAGTGATGG + Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097811048 12:64019584-64019606 ATCTCCTTTTAGAATAAAAAGGG - Intronic
1097820413 12:64123029-64123051 ATGTCATTAAAGAATATTAATGG + Intronic
1098720491 12:73891578-73891600 AGCTAATTCAAGAATAGAAAAGG - Intergenic
1099146715 12:79055001-79055023 ATCTTATTATAGCATAGTACTGG + Intronic
1099882477 12:88483325-88483347 AGGTCATTATAGAATAATAAGGG + Intergenic
1099908595 12:88801820-88801842 AACTCATTGTAGAGTAGAAAGGG - Intergenic
1101071900 12:101084473-101084495 ATGTCATTTTAGAACAGTAAAGG + Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1103475238 12:121213068-121213090 ATCTCAGTGTAGAGTAGGAACGG - Intronic
1104283074 12:127396251-127396273 ATTTCATTCTAGTAGAGGAATGG - Intergenic
1104689648 12:130815923-130815945 ACTTCATTTTAGAATAGTAAAGG + Intronic
1105234860 13:18540776-18540798 ATTTTATTCAAGAATAGGAAAGG - Intergenic
1108280859 13:48860184-48860206 ATTTCATTTTAGAATGGTAAAGG + Intergenic
1108792542 13:53989199-53989221 ATCCCATTTTAGTATAGTAAAGG - Intergenic
1108853919 13:54770163-54770185 ATAACATTCTAGAATAATAAGGG + Intergenic
1109970993 13:69769336-69769358 ATCTCAGTGTATAATAGTATAGG + Intronic
1112320204 13:98399452-98399474 ATCTCATTCTAGCTTAACAAGGG + Intronic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1117118482 14:52541458-52541480 ATTTCACTCTAGAATGATAATGG - Intronic
1117476220 14:56097742-56097764 CTCCAATTCTAGAAAAGTAATGG + Intergenic
1117897062 14:60498274-60498296 AGCTCATTCAACATTAGTAAGGG - Intronic
1118103050 14:62627469-62627491 ATATTTTTCAAGAATAGTAATGG + Intergenic
1119884397 14:78128259-78128281 GTCTCTTTCTAGAAAAGCAAAGG - Intergenic
1120362117 14:83517684-83517706 TTTTCTTTCTAGAATAGAAATGG - Intergenic
1121668837 14:95692660-95692682 ACCTCTTTCTAGCATAGAAATGG + Intergenic
1125260182 15:37814637-37814659 ATCTATTTCTAGAACAGAAAGGG + Intergenic
1126538224 15:49792214-49792236 ATCTCATTCTGAAATATGAATGG + Intergenic
1127540611 15:59934989-59935011 ATCTTTTTGTAGAAAAGTAAGGG - Intergenic
1129081367 15:73044039-73044061 ATCTCAGACTAGAATATTGAAGG - Intergenic
1133843582 16:9433183-9433205 ATCTCATTATATAATGATAAAGG - Intergenic
1134785700 16:16940981-16941003 AACCCATTATAAAATAGTAATGG - Intergenic
1139807653 16:69582309-69582331 GTCTTATTCTTGAATTGTAAGGG + Intronic
1141359820 16:83385139-83385161 ATTTCATCCTATAAAAGTAAGGG + Intronic
1145107174 17:20127971-20127993 ATTTCATTTTAGGATATTAAAGG - Intronic
1149941048 17:60866996-60867018 ATCTCATTCTAGAATGTATATGG - Intronic
1152216999 17:79039117-79039139 ATCTCTTTCTAGTCTAGCAAAGG - Intronic
1153617323 18:6947025-6947047 ATCTGTTTTTAAAATAGTAATGG + Intronic
1154402430 18:14053709-14053731 ATTTCATTCTCCACTAGTAATGG + Intergenic
1154514680 18:15149096-15149118 ATTTTATTCAAGAATAGGAAAGG + Intergenic
1155540900 18:26867277-26867299 ATCTCATTCTAAAATCCAAATGG - Intergenic
1155970329 18:32076965-32076987 TTCTCATTCTAGTACAGTTATGG - Intergenic
1156192167 18:34732445-34732467 TTCTCATTTTAGATAAGTAAAGG - Intronic
1156330445 18:36116772-36116794 TTCTGATTCTAAAATAGTGAGGG + Exonic
1158662554 18:59401811-59401833 ATCTCATTGTAGGATACTAGAGG + Intergenic
1158664367 18:59419355-59419377 ATCTCAATCAAGAATAATTATGG + Intergenic
1159738716 18:72137508-72137530 ATCTCTTTGTAGAAAAGCAAGGG - Intergenic
1162229779 19:9256542-9256564 ACATCCTTCTAGAATAGTGATGG - Intergenic
1163178484 19:15582428-15582450 ATCTCATTCTAGAGTGTTGAGGG + Intergenic
1164631334 19:29763686-29763708 GTCTCCTTCCAGATTAGTAATGG + Intergenic
1166985014 19:46654598-46654620 ATCTCATTTTAGAAAAGAGAGGG + Intronic
1202705161 1_KI270713v1_random:17309-17331 ATCTGATTCTACAAGAGTAAGGG - Intergenic
926681811 2:15669764-15669786 ACCTCCTACTAGAATAGGAATGG - Intergenic
927407548 2:22788877-22788899 ATTTCATTTTAGACTTGTAAAGG - Intergenic
928686496 2:33755343-33755365 AAGGCATTCCAGAATAGTAAAGG - Intergenic
928862741 2:35878139-35878161 ATTTCATTTTAGGATAATAATGG - Intergenic
928870914 2:35977787-35977809 AGCTCATTATAGAATAGAAAAGG + Intergenic
929386028 2:41408104-41408126 ATCTCATTCTAAAATGCAAATGG - Intergenic
929518326 2:42624714-42624736 ATTTCATACCAGAATAGTATAGG - Intronic
930695581 2:54408234-54408256 ATGTCATTTTGGAATAGTACAGG - Intergenic
932303098 2:70681786-70681808 ATATTATTCTAGAATAATATTGG - Intronic
932480953 2:72038848-72038870 ATTTCATTTCAGGATAGTAAAGG - Intergenic
933666492 2:84969503-84969525 ATCTCTTTCTACAAGAGAAATGG + Intergenic
935192316 2:100788452-100788474 ATTTCATTCTATAATGTTAAGGG - Intergenic
935319131 2:101868550-101868572 ATCTCAGTGTGGAAGAGTAAAGG + Intronic
935882432 2:107578384-107578406 ATCTCATAGAAGAATAGTGATGG - Intergenic
936748340 2:115608653-115608675 ATCTCTTTCTTAAATATTAATGG + Intronic
937614376 2:123903811-123903833 ATTTCATTTCAAAATAGTAAAGG - Intergenic
938275259 2:130014968-130014990 AACTCATTCTGCAAGAGTAAAGG - Intergenic
938440104 2:131322310-131322332 AACTCATTCTGCAAGAGTAAAGG + Intronic
938514931 2:131993860-131993882 ATTTTATTCAAGAATAGGAAAGG + Intergenic
938623996 2:133088646-133088668 ATTTCATTTCAGGATAGTAAAGG - Intronic
939042938 2:137214004-137214026 ATCTCATTTAATAATAATAATGG + Intronic
939817915 2:146919428-146919450 AATTCATTCTAGAACAATAAGGG - Intergenic
940941521 2:159566824-159566846 ATCTTATTTTAGAACAGTAAAGG - Intronic
942395950 2:175549750-175549772 ATCTCATTTGAAGATAGTAAAGG - Intergenic
943090555 2:183369516-183369538 ATCCCATTTTAGAGTACTAAAGG - Intergenic
944309838 2:198221605-198221627 TTCCCTTTCTAGAATATTAAGGG + Intronic
945723828 2:213451190-213451212 ATTTCATTTCAGGATAGTAAAGG + Intronic
946912342 2:224476722-224476744 ACCACATTCTAGAAAAGGAAAGG - Intronic
947076236 2:226349030-226349052 ATCACATTCTGGAATACTGAGGG - Intergenic
948782497 2:240330435-240330457 ATCTCATTTTGGAAAAGTAGGGG - Intergenic
1169610236 20:7371365-7371387 ATTTCATTTTAGAGTAGTAAAGG + Intergenic
1169936924 20:10893569-10893591 ATCCCATTTAAGAATAGTTAAGG + Intergenic
1171429848 20:25076061-25076083 ATTTCATTCTAGAATGGAAACGG - Exonic
1172198640 20:33109760-33109782 ACCTTATTCCAGAATAATAAGGG + Intronic
1173694391 20:44996205-44996227 GTCTCCTTCTAGAATGTTAAGGG + Intronic
1176778854 21:13169055-13169077 ATTTTATTCAAGAATAGGAAAGG - Intergenic
1176935633 21:14863398-14863420 GTCTTATTCTAGAAAATTAAGGG + Intergenic
1177019122 21:15830719-15830741 ATCTTATTGTAAAATAATAAGGG + Intronic
1177326858 21:19601857-19601879 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1177611780 21:23458837-23458859 AGCTCATTGTAGAATAGTTCAGG - Intergenic
1177621813 21:23605133-23605155 ATATCATTATATAATAATAAGGG + Intergenic
1177976495 21:27858206-27858228 ATTTTATTCAAGAATAGGAAAGG - Intergenic
1178770823 21:35502191-35502213 ATCACATTGTAGCATAATAATGG + Intronic
1179002275 21:37473096-37473118 CTCTCATTCTGTAATAGAAAGGG + Intronic
1179283439 21:39954441-39954463 ATATCCCTCTAGAATAGTAGTGG - Intergenic
1181434612 22:22903261-22903283 ATGTCATTCCAGGACAGTAATGG - Intergenic
1181709852 22:24676866-24676888 ATTTCATTTCAGGATAGTAAAGG + Intergenic
1181919185 22:26306806-26306828 GTCTTATTCTAGAATATTATGGG + Intronic
1182019432 22:27068453-27068475 ATCTCATTCAAGCCTAGAAATGG - Intergenic
1182450800 22:30419674-30419696 ATTTCACTTCAGAATAGTAAAGG - Intronic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
1184997584 22:48220578-48220600 AATTCATTCTAGAATAGAAATGG + Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951987240 3:28634295-28634317 ATCTAATTCTATAATAGCAAGGG - Intergenic
952670304 3:35958905-35958927 ATCTCATTCTTCAATATAAATGG - Intergenic
953012845 3:39044104-39044126 ATGTCATTATATAATAATAAAGG + Intergenic
953157633 3:40389015-40389037 ATATGATTTTAGGATAGTAAGGG + Intronic
955002318 3:54938821-54938843 ATATGATTCTAGAAAAGTCAGGG + Intronic
955185976 3:56715543-56715565 ATCTGATTTTAAAATAGTAATGG - Intergenic
957534301 3:81481425-81481447 ATCTCAATACAGAATAGCAAGGG - Intergenic
957750863 3:84413533-84413555 ATGCCCTTCTAGAATAGTGAAGG - Intergenic
958193815 3:90217451-90217473 ATTTCGTTATAGAATAGTAAAGG + Intergenic
958417170 3:93888500-93888522 ATTTCATTATAGAATAGTAAAGG + Intronic
958692705 3:97488279-97488301 TTCTCTTTCTAGAATAGTCCAGG + Intronic
959306314 3:104670864-104670886 ATCTCATTCTGAAGTAGGAAAGG - Intergenic
959412790 3:106046367-106046389 ATCTCATTTTAAAATGGAAATGG + Intergenic
959752251 3:109852178-109852200 ATGTCATTATATAATGGTAAAGG + Intergenic
960548501 3:118946547-118946569 GTCTTATTCAGGAATAGTAAGGG - Intronic
960591547 3:119371187-119371209 ATCTCATTCTATTATAGTTGGGG + Intronic
962604859 3:137024771-137024793 ATCTCTTTCTAGGATTGTCATGG - Intergenic
962766421 3:138567910-138567932 ATCTCATTCTATTATAGAGAAGG - Intronic
963397493 3:144752201-144752223 ATCTTTTCCTAGAATAATAAAGG + Intergenic
964227669 3:154427145-154427167 ATCTCATTCTAGACTTGGGAGGG + Intronic
964451648 3:156818257-156818279 ACTACATTCTAGAAGAGTAAAGG - Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
971601806 4:28601482-28601504 ATCTATTTCTAGAATAATCATGG + Intergenic
973822770 4:54677304-54677326 ATCTCATTCTACTATGGGAAAGG + Intronic
973897271 4:55426558-55426580 ATATGATTCTAGAATATAAAAGG - Intronic
974452046 4:62077150-62077172 CTTTCATTCTAGAATACTAAAGG + Intronic
975923881 4:79425519-79425541 TTCTCATCCTTGAATAGGAAAGG - Intergenic
976484252 4:85582955-85582977 TTCTCAATCCAGAATATTAAAGG - Intronic
977635370 4:99292301-99292323 ATATCTCTCTAGAATTGTAAAGG + Intergenic
977982338 4:103339123-103339145 ATACCATTTTAGAATACTAAAGG - Intergenic
978881156 4:113704244-113704266 TTTTCATTCTAGAATTGTTAAGG - Intronic
980045290 4:127981030-127981052 ATCTCATTGGAACATAGTAATGG + Intronic
981655575 4:147108826-147108848 ATTTCTTTCTAAGATAGTAAAGG + Intergenic
985886497 5:2684401-2684423 ATCTCATTCCAGAAAATAAAAGG + Intergenic
987211469 5:15688190-15688212 ATCACATTTTAGGATACTAAAGG + Intronic
987428865 5:17806703-17806725 ATCTCATTTTGCAATAGCAAGGG + Intergenic
989226244 5:39032917-39032939 AGCTCAGACTAGATTAGTAAAGG + Intronic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
991266249 5:64721792-64721814 ATAACATTCTATAATAGTAAAGG - Exonic
992074065 5:73174763-73174785 GTCTCCTGCTAGAATAGTATTGG + Exonic
994467662 5:100159043-100159065 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
997018807 5:129971866-129971888 ATCTCACTTTACAACAGTAAGGG - Intronic
997151618 5:131502260-131502282 ATTTCAGACAAGAATAGTAATGG + Intronic
999078401 5:148819269-148819291 ATCTGATGCTAGAATACTAACGG + Intergenic
999583712 5:153067443-153067465 ATCTCATTGTAGAATCCTTAGGG + Intergenic
1002986468 6:2193634-2193656 ATTTCATTTTAGGATTGTAAAGG + Intronic
1005597820 6:27396124-27396146 ATTTTATTTCAGAATAGTAAAGG - Intronic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1009639223 6:66308877-66308899 ATCTCATTACAGTTTAGTAAGGG + Intergenic
1010685326 6:78847787-78847809 ATATGATCCTAGAATAGTACAGG + Intergenic
1010916783 6:81628862-81628884 TTATCATTCTAGAAAAGTATTGG + Intronic
1012257639 6:97052021-97052043 ATTTCATTTTAGGATAGTAAAGG - Intronic
1013162451 6:107558573-107558595 ATCTAGTTCTTGAATAGCAAAGG + Intronic
1013919531 6:115385920-115385942 ATCTCATTGTTGAATATTTAGGG - Intergenic
1014024264 6:116626985-116627007 ATCTTCTTTTAGGATAGTAAGGG + Intronic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1014188998 6:118469905-118469927 ATCTCATTATAGAAAAATACAGG - Intronic
1014242889 6:119037534-119037556 ATCTCATTCAAGAATATTGATGG - Intronic
1014293407 6:119587989-119588011 ATATCTTTCAAGAGTAGTAATGG - Intergenic
1014567352 6:122966073-122966095 ATCCCATACTAGAACAGTGAAGG - Intergenic
1014696830 6:124632379-124632401 AGCTCATTCTCTAACAGTAATGG - Intronic
1015371712 6:132461669-132461691 TTCTCATTCTTTAATATTAATGG + Intronic
1015579008 6:134703182-134703204 ATTTCATTCTAAAAGACTAATGG + Intergenic
1016178198 6:141107112-141107134 ATCTCATTTTAAAACAGTAATGG + Intergenic
1016427468 6:143949587-143949609 ATCTCTCTCTAGAATAGCACAGG - Intronic
1018622458 6:165743783-165743805 TTCTCATTGTAGAATAGACAGGG - Intronic
1019632031 7:2054592-2054614 ATGTCAGTCTAGAAAGGTAATGG + Intronic
1020578845 7:9969459-9969481 ATCTTATTCTAAAATATTTATGG + Intergenic
1021362210 7:19729578-19729600 ATCTCATTCTAGAATAGTAAAGG + Intronic
1021480837 7:21114663-21114685 ATCTCCTTGTAGAATGGCAAAGG - Intergenic
1022451090 7:30515855-30515877 ATCTCATTCCAGTATAGCTATGG - Intronic
1022708306 7:32827478-32827500 ATTACATTCTAGAAAAGTCATGG + Intergenic
1022914865 7:34938011-34938033 ATTACATTCTAGAAGAGTCATGG - Exonic
1023206862 7:37760177-37760199 ATTTCATGCTATAAAAGTAAAGG - Intronic
1023896788 7:44440442-44440464 ACCTAATTCTGGAATAGAAAAGG + Intronic
1024338341 7:48231961-48231983 ATCTCATTGTACAATAGTTCAGG - Intronic
1027008290 7:74717660-74717682 TTTTCATTCTAGAAAAATAAGGG - Intronic
1027453052 7:78354719-78354741 ATCCCATTCTAGCATATAAAAGG - Intronic
1027907867 7:84209499-84209521 ATCTCATTCATGTATAGAAAAGG - Intronic
1028357106 7:89923880-89923902 ATCACATTTTGGAAGAGTAAAGG - Intergenic
1029236538 7:99124418-99124440 ATCTCATTCTAGAATACTTTTGG + Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030085890 7:105815352-105815374 ATCTCAATGTAGAACAGTTAGGG - Intronic
1032594055 7:133221696-133221718 TTCTCCTACTAAAATAGTAAAGG + Intergenic
1032998538 7:137477033-137477055 ATCTCATTCTACTCTAGTCAAGG + Intronic
1033822237 7:145148490-145148512 ATGTGGTTCTAGAAAAGTAAGGG - Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1034368054 7:150569185-150569207 ATCTGATTGTAGAGTAGAAAAGG + Intronic
1036541609 8:9718923-9718945 AACTTATTCTATTATAGTAATGG - Intronic
1037267179 8:17076445-17076467 ATCTGATTATAGAATAGGAATGG - Intronic
1037933037 8:22894963-22894985 ATCTGATTCTAGAATAGGTCAGG - Intronic
1039888819 8:41670968-41670990 ATCTCTTTCTACAATGGCAAGGG + Intronic
1041098189 8:54370677-54370699 AACACATTCTAGATTAATAAAGG - Intergenic
1041976620 8:63806140-63806162 GTCACATTCTAGAAATGTAATGG - Intergenic
1042940711 8:74104929-74104951 AATACATTCCAGAATAGTAAAGG - Intergenic
1045130097 8:99141499-99141521 ATGTAATTCTAGAAATGTAATGG + Intronic
1045783343 8:105894237-105894259 ATATCATTCTAGAAAAATAAGGG + Intergenic
1049310866 8:141933165-141933187 GTCTCATTCTAAAATACTAGGGG + Intergenic
1049961980 9:745637-745659 ATCTCATTCCAGCATAGTTTTGG + Exonic
1050510155 9:6385812-6385834 AGGTCATTATATAATAGTAAAGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051160524 9:14202468-14202490 ATCCCATTATAGAATATTGATGG + Intronic
1052055995 9:23908390-23908412 ATTTAATTCTGGAATAGAAAGGG + Intergenic
1053305737 9:36983545-36983567 ATTTCATTTTAGGATAGCAAAGG + Intronic
1054813475 9:69453227-69453249 ATTTCATTTCAGGATAGTAATGG + Intronic
1055851281 9:80633325-80633347 ATCTAAGTATAGATTAGTAAAGG - Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056138155 9:83649158-83649180 ATCTCATTTTGTGATAGTAAAGG + Intergenic
1058120295 9:101131206-101131228 AACTCATTCTGGAATAATCATGG + Intronic
1059361075 9:113742483-113742505 ATCTCATTACAAAATGGTAATGG + Intergenic
1060132523 9:121118091-121118113 CTGTCATTCTATAATAGTATAGG - Intronic
1060582783 9:124767070-124767092 ACCACATTTTAGAATAGTAGAGG - Intronic
1061995971 9:134186055-134186077 ATTTCCTTCTAGAATGGTAGTGG + Intergenic
1185738996 X:2515368-2515390 ATCTTATTTTAGAATAGAATGGG + Intergenic
1189037901 X:37511249-37511271 AAATCATTCTAGAATATTAATGG - Intronic
1190357111 X:49616351-49616373 TTCTCGTTGTAGAATAGGAATGG - Intergenic
1190958060 X:55216683-55216705 ATGTCACTCTATAATAATAAAGG - Intronic
1191798148 X:65045500-65045522 ATCTCATGCTAAAACAATAATGG - Intergenic
1192983595 X:76372700-76372722 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1193230330 X:79036980-79037002 AACTCATCGTAAAATAGTAAAGG - Intergenic
1193527761 X:82614163-82614185 ATCACATTCTAAAAAAGAAAAGG + Intergenic
1195637055 X:107129705-107129727 ATATCATTCTTGAATATAAATGG + Intronic
1196007072 X:110848381-110848403 GTCTCATTTTAGGACAGTAAAGG - Intergenic
1198141414 X:133807603-133807625 AACTCTTTCTAGACTAGAAAAGG + Intronic
1199143814 X:144341340-144341362 ATCTCATTATATAATGATAAAGG + Intergenic
1200154254 X:153966997-153967019 ATCTCATTCTAGAACACTCCAGG + Intronic
1200829007 Y:7672923-7672945 ATCTCATTCTGGATTTGAAATGG - Intergenic
1201862394 Y:18613580-18613602 TCCTTATTCTAAAATAGTAATGG - Intergenic
1201870929 Y:18706800-18706822 TCCTTATTCTAAAATAGTAATGG + Intergenic