ID: 1021364247

View in Genome Browser
Species Human (GRCh38)
Location 7:19756750-19756772
Sequence GGTCTTTTGCAGGACATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 1, 2: 19, 3: 58, 4: 268}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021364247_1021364252 15 Left 1021364247 7:19756750-19756772 CCATCCATGTCCTGCAAAAGACC 0: 1
1: 1
2: 19
3: 58
4: 268
Right 1021364252 7:19756788-19756810 TTATGTCTGCATAGTATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021364247 Original CRISPR GGTCTTTTGCAGGACATGGA TGG (reversed) Intronic
900229225 1:1547889-1547911 GGACTTCTGCAGGACCTGGGCGG - Intronic
901078404 1:6569918-6569940 GGTCTTTGGCAGGTTCTGGAAGG + Intronic
904227288 1:29033081-29033103 TTTCTTTTTCAGGACTTGGAAGG + Exonic
904627504 1:31815242-31815264 GAGCTTTTACAGAACATGGAAGG - Exonic
904691469 1:32296321-32296343 GGTAGATTGCAGTACATGGATGG + Intronic
904799696 1:33083659-33083681 GGTATTCTGCAGGACATGGTGGG + Intronic
906020290 1:42622240-42622262 TGTCATTTGCAATACATGGATGG - Intronic
906870900 1:49479607-49479629 TGTCCTTTGCATGACATGGATGG - Intronic
909503096 1:76357380-76357402 GGTCTTTTGGAGGCCAAGGCGGG - Intronic
910612599 1:89161086-89161108 GATCATTTGCAGGGTATGGATGG - Intronic
910632932 1:89375072-89375094 GTCCTTTTCAAGGACATGGATGG - Intronic
911144902 1:94542104-94542126 GGTCTATGGCAGGAAAGGGAGGG + Intergenic
911151986 1:94605091-94605113 GGCCTTTTGAGGGCCATGGAGGG - Intergenic
911710590 1:101067106-101067128 CCTCCTTTGCAGGACATGGATGG - Intergenic
912788237 1:112625064-112625086 GGTGTTTTACAGGAGATGAAGGG - Intronic
913212306 1:116591756-116591778 GGGCTCTGGCAGGACATGGGAGG - Intronic
914504157 1:148274378-148274400 GGACTTTGGCAGGACAAGGCAGG + Intergenic
914994258 1:152527576-152527598 TGTCTTTTACAGAACATGGATGG - Intronic
916801833 1:168223144-168223166 GGTGTTTTCCAGGACAAGGTAGG + Intergenic
919204586 1:194405750-194405772 TGTTCTTTGCAGGACATGGATGG + Intergenic
919598744 1:199596594-199596616 TGTCCTTTGCAGGAAATGGATGG - Intergenic
923248858 1:232160892-232160914 GGCCTCTTGCAGGACTGGGATGG + Intergenic
1063985782 10:11500007-11500029 GTCCTTTGCCAGGACATGGATGG + Intronic
1065294335 10:24260021-24260043 TGTCTCTTGTAGGAAATGGAGGG + Intronic
1065700014 10:28415732-28415754 TGTCTTTTGCGGAACATGGATGG - Intergenic
1067989586 10:51196139-51196161 GGTCTTTAGTAGGACAAGGTTGG + Intronic
1071388212 10:85143047-85143069 GTCCTTTTCCAGCACATGGAAGG - Intergenic
1071982721 10:91020021-91020043 GGTCTTTAGGAGGCCAAGGAGGG + Intergenic
1072782743 10:98261438-98261460 AGGCTTTTGCTGGGCATGGAAGG + Intronic
1073825639 10:107317456-107317478 GTTCTTTGCCAGGATATGGATGG + Intergenic
1073916468 10:108410215-108410237 GTCCTTTGGGAGGACATGGATGG - Intergenic
1073952948 10:108831848-108831870 TGTCCTTTCCAGGACATGGATGG + Intergenic
1074022718 10:109600824-109600846 CATCCTTTGAAGGACATGGATGG + Intergenic
1074222110 10:111448121-111448143 GGTCTTTTGCAGCAACTTGAAGG - Intergenic
1075187598 10:120277033-120277055 TGTCCTTTGAAGGACATGGATGG + Intergenic
1075220475 10:120580272-120580294 GATCTTTTTCTGGAAATGGATGG + Intronic
1075500508 10:122969498-122969520 TTTTTCTTGCAGGACATGGATGG + Intronic
1078118552 11:8481404-8481426 CGTCTTTTGCTGGACATAAATGG - Intronic
1078517753 11:12039156-12039178 TGTCCTTTGCAGCACATGGATGG + Intergenic
1078975287 11:16467475-16467497 TGTCCTTTGCAGGACATGGATGG + Intronic
1079118631 11:17658951-17658973 GGCATGTTGCAGGAAATGGAGGG + Intergenic
1079374745 11:19881832-19881854 GGTCTCTCTCAGGACATGAAGGG + Intronic
1080961236 11:37162819-37162841 GGTCTTCTGCAGGAGAAGAAAGG + Intergenic
1082638814 11:55629414-55629436 GGCCTTTGCAAGGACATGGATGG - Intergenic
1082904093 11:58287185-58287207 TGTCTTTTGCAGAACATAGATGG + Intergenic
1083515046 11:63249553-63249575 GTCCTTTTGAGGGACATGGATGG + Intronic
1083919649 11:65775433-65775455 TGTCCTTTGAAGGATATGGATGG + Intergenic
1084765800 11:71307549-71307571 AGTCCTTTACAAGACATGGAAGG - Intergenic
1085141304 11:74144754-74144776 TGTCCTTTGCAGGACATGGATGG - Intronic
1085164409 11:74383748-74383770 GTTCTTTGTAAGGACATGGATGG - Intronic
1085257243 11:75182091-75182113 GGTCTTGTGCAGGACACAGTGGG - Intronic
1090586941 11:128223197-128223219 TGTCCTTTGCAGGACATGGATGG - Intergenic
1091180526 11:133600317-133600339 GTTGTTTTGCAGCAAATGGATGG + Intergenic
1091348666 11:134874774-134874796 AGTCCTTGGAAGGACATGGAAGG + Intergenic
1092340446 12:7671590-7671612 GCACTTTTGGAGGCCATGGAGGG - Intergenic
1093084937 12:14856439-14856461 TGTCTTTTGGATGTCATGGATGG - Intronic
1093213831 12:16339461-16339483 GATGTCTTGCAGCACATGGAAGG + Intergenic
1094569511 12:31629309-31629331 GCCCTTTTGCAGAACATGAAGGG - Intergenic
1095073281 12:37884433-37884455 GTTTTTTTGTAGGATATGGAAGG - Intergenic
1097538359 12:60902502-60902524 TGTCATTTGCAACACATGGATGG + Intergenic
1097627840 12:62022231-62022253 AGTCTTTAGCAGGACATGTAAGG - Intronic
1100324849 12:93531179-93531201 GGTTTCTAGCAGGCCATGGACGG + Intergenic
1101190279 12:102325623-102325645 GGTTTTTTCCATGACATGCAGGG - Intergenic
1101264794 12:103073018-103073040 GTCCTTTGCCAGGACATGGATGG + Intergenic
1102402192 12:112639336-112639358 TGTCCTTTGCAGGCTATGGATGG + Intronic
1102806916 12:115790120-115790142 TGTCATTTGCAGAACATGGATGG - Intergenic
1104796459 12:131523204-131523226 TATCCTTTGCAGGACATGGATGG + Intergenic
1105215552 13:18282379-18282401 GGGCTCTGGCAGGACATGGGAGG - Intergenic
1108738978 13:53314998-53315020 TGTCTTTTGCAGAACTTGGGTGG + Intergenic
1110290400 13:73799099-73799121 CGTCTTTTGCAGCACATGGATGG + Intronic
1110894433 13:80731566-80731588 TGTCTTTTCAGGGACATGGATGG - Intergenic
1110907759 13:80914387-80914409 GTTCTGTTGCAATACATGGAAGG - Intergenic
1110972907 13:81788854-81788876 AGTCATTTGCAGAACGTGGATGG - Intergenic
1111489235 13:88948644-88948666 GGTCTGTGGCAGGCCCTGGATGG + Intergenic
1112120843 13:96409135-96409157 GGTATTTGGCTGGATATGGAAGG + Intronic
1113368932 13:109705320-109705342 GGGCTTTGGCAGGGCAGGGAAGG + Intergenic
1114136066 14:19852550-19852572 GTCCTTTGCCAGGACATGGATGG - Intergenic
1114829139 14:26118231-26118253 TGTCCTTTGCAGGACATGGATGG + Intergenic
1114944683 14:27664887-27664909 GTTCTTTATAAGGACATGGATGG - Intergenic
1115329079 14:32174669-32174691 TGTCTTTTGCAGCATGTGGATGG - Intergenic
1115764714 14:36611837-36611859 TGTTTTTTGCAGGACATGGATGG + Intergenic
1116035544 14:39622798-39622820 TGTCCTTGGCAGGACATGGATGG - Intergenic
1116362106 14:44013070-44013092 GGACTTTGGGAGGACAAGGAGGG + Intergenic
1116943687 14:50816036-50816058 TGTCCTTTGCAAGACATAGATGG + Intronic
1117842462 14:59873976-59873998 TGTCATTTGCACAACATGGATGG - Intergenic
1118004151 14:61550295-61550317 GGTCTTTTTAAGGAAATGAAGGG + Exonic
1118390547 14:65291839-65291861 GGTCTTGGGCAGGAAAAGGAAGG - Intergenic
1118915185 14:70096820-70096842 GGTCTTTTGCGGGATGAGGAGGG + Intronic
1119583492 14:75809869-75809891 TGTCATTTGCAGAACATAGATGG - Intronic
1120058955 14:79959374-79959396 TGTCCTTTGAGGGACATGGATGG + Intergenic
1121972879 14:98374961-98374983 AGTGTTTTGCAGGACTTGTATGG - Intergenic
1123005972 14:105324043-105324065 GCTTTTGTGCAGGAGATGGAGGG + Intronic
1126364260 15:47877565-47877587 GGTCTATTGTGGGACAGGGAAGG - Intergenic
1126959654 15:53977437-53977459 GGCATTTTTCAGTACATGGAGGG - Intergenic
1129242361 15:74259189-74259211 GGTCTTTGGGGGGACAGGGAGGG + Intronic
1130249549 15:82289277-82289299 GTTCTTTTCAGGGACATGGATGG + Intergenic
1132245293 15:100291679-100291701 TGTCCTCTGCAGCACATGGATGG + Intronic
1132248813 15:100318045-100318067 GGACATTTGCAGGACATGGAAGG + Intronic
1137906106 16:52323525-52323547 GGTCCTTAGCACGACCTGGAAGG - Intergenic
1138510125 16:57503920-57503942 GGTCCCTTGCAGGACAGGGCTGG - Intergenic
1139134568 16:64186376-64186398 AATCTTTTGCAGAAAATGGATGG - Intergenic
1139366369 16:66436049-66436071 GGGCTTTTGCAGGGCATAGCTGG - Intronic
1140613223 16:76626359-76626381 GCCCTTTTGCAGGTCATGGCTGG - Intronic
1141386687 16:83627911-83627933 AGACTTTTCCAGGAAATGGATGG + Intronic
1141483474 16:84322859-84322881 TGTCTTGGGCAGGACAAGGAGGG - Intronic
1142261249 16:89043423-89043445 CGTCTTCTTCAGGACAGGGAAGG - Intergenic
1142292609 16:89199906-89199928 GGGATTGAGCAGGACATGGAGGG - Intronic
1143025094 17:3936875-3936897 TGTGTGTTGCTGGACATGGATGG - Intronic
1143246501 17:5490632-5490654 GCTCTTTAGGAAGACATGGAGGG - Exonic
1143786442 17:9259369-9259391 GCTCTGTTGCAGGACATTTACGG - Intronic
1144239669 17:13297937-13297959 GGTCCTTTGTAGGAAATGAAGGG + Intergenic
1144655508 17:17032680-17032702 TTTCTTTTTCAGGACATGCAGGG - Intergenic
1145218242 17:21068323-21068345 GGTGTTTTGGAGGAGCTGGAAGG - Intergenic
1145939650 17:28736077-28736099 TGTCCTTTGTAGGACATGGATGG - Intronic
1147996195 17:44361759-44361781 GTTCATTTGTAAGACATGGAAGG - Intronic
1148227127 17:45906825-45906847 GGTCTGTTCCAGGATGTGGAGGG - Intronic
1151052184 17:70990839-70990861 TGTCTATTGCAGGAGATGAAAGG + Intergenic
1151747486 17:76019119-76019141 GGCCTTTTGAAGGACAGGTATGG - Intronic
1151973777 17:77472474-77472496 GCTCCTTTGCAGGACCTGGAAGG - Intronic
1152241173 17:79161972-79161994 GGACTTTTGGGGGACAGGGATGG + Intronic
1153134051 18:1892891-1892913 ATTCTTTTTCAGGACATTGATGG - Intergenic
1153474841 18:5488260-5488282 TGTCCTTTTCAGGACATGGATGG + Intronic
1153837250 18:8974975-8974997 TGTCATTTGCAAAACATGGATGG + Intergenic
1154302811 18:13209246-13209268 TGTCCTTTGCAGGATGTGGATGG - Intergenic
1155257440 18:24011208-24011230 GGTCTGCTCCAGGACCTGGATGG - Intronic
1156715364 18:40002561-40002583 TGTATTTTGCAGAACATGGATGG + Intergenic
1160081765 18:75734559-75734581 TGTCCTTTGCAGGACATGGATGG - Intergenic
1161846875 19:6716770-6716792 TCTCATTTGCAGGACATGGCAGG + Intronic
1165590781 19:36967680-36967702 GGGCTTTTGCCAGAAATGGATGG - Intronic
1166665170 19:44675408-44675430 TGTGTTTTGCAGGAGATGTAGGG - Intronic
1167772484 19:51529959-51529981 GGTGTTTTGCAGGATTTTGAAGG + Exonic
1167837661 19:52087517-52087539 GTCCTTTCCCAGGACATGGATGG - Intronic
1168112843 19:54204061-54204083 GTTCTTTTTCAGGAGATAGATGG + Intronic
927085124 2:19667536-19667558 TGTCTTTTGCAGGCCTTGAATGG + Intergenic
928258685 2:29747587-29747609 GGTCCTGTGCTGGACATTGAGGG - Intronic
928705208 2:33941971-33941993 GTTCTTTGGAGGGACATGGATGG + Intergenic
929371232 2:41226187-41226209 GTCCTTTTCAAGGACATGGATGG + Intergenic
930191593 2:48465723-48465745 TGTCCTTTGCAGTACTTGGATGG - Intronic
930310752 2:49736551-49736573 GTTTTTTTCAAGGACATGGATGG - Intergenic
931502148 2:62881080-62881102 TGTTCTTTGCAGCACATGGATGG + Intronic
931798415 2:65734362-65734384 TTTTTTTTGCAGGACATGGATGG - Intergenic
932647463 2:73518268-73518290 TGTCTTTTGCAGAACATGGATGG - Intronic
932977293 2:76618693-76618715 TGTCATTTGCAGTACATGGGTGG - Intergenic
934298776 2:91764346-91764368 GGGCTCTGGCAGGACATGGGAGG + Intergenic
935627380 2:105182536-105182558 AGTCATTTGCACCACATGGATGG - Intergenic
937231903 2:120402968-120402990 GTTCTTTGCAAGGACATGGATGG - Intergenic
937232977 2:120411006-120411028 GTTCTTTGCAAGGACATGGATGG - Intergenic
937464304 2:122116921-122116943 TGTCATTTTCAGCACATGGATGG - Intergenic
937735966 2:125289750-125289772 TGTCCTTTGCGGGACATGGATGG - Intergenic
947584919 2:231349267-231349289 AGTCATTTGCAAAACATGGATGG + Intronic
947937711 2:234022234-234022256 GGTCTGTTGCAGGAGTTGGATGG + Intergenic
948020972 2:234732909-234732931 GGTCTTTTCCAGGCTAGGGAGGG - Intergenic
1169294443 20:4381655-4381677 GTTCTTGTGAATGACATGGAGGG - Intergenic
1169807994 20:9579277-9579299 GTTCTTTTGCTGGACAGGTAAGG + Intronic
1170157811 20:13284652-13284674 GGTCTTTGCCGGGACATTGATGG + Intronic
1170708810 20:18770229-18770251 CGTCATTTGCAAAACATGGATGG - Intergenic
1171207331 20:23291102-23291124 GGCCATTTGTAGGACAAGGACGG - Intergenic
1172302117 20:33857674-33857696 CAGCTTTTGCAGGACAGGGAGGG - Intergenic
1172544905 20:35752682-35752704 GGTCTTTGCCAGGAGCTGGAGGG + Intergenic
1172611611 20:36256601-36256623 GGTCTTCTTCAGCACTTGGAAGG - Exonic
1173333856 20:42097669-42097691 GGCCTTGTGCAGGCCTTGGATGG - Intronic
1173743183 20:45416712-45416734 GCCCTGTTGCAGGCCATGGAGGG + Intronic
1173773961 20:45687314-45687336 GTTCTTTGCAAGGACATGGATGG - Intronic
1175114268 20:56671004-56671026 AGTCTTTCCCAGCACATGGAGGG + Intergenic
1176902921 21:14465254-14465276 GTCCTTTGCCAGGACATGGATGG - Intergenic
1177709963 21:24761374-24761396 GTTCTTTGAAAGGACATGGATGG - Intergenic
1177764848 21:25445870-25445892 TGTCTCTTGCAGAACATAGATGG + Intergenic
1179114918 21:38482110-38482132 GGTCCCTTCCAGGCCATGGATGG - Intronic
1179410128 21:41156120-41156142 GGCTCTTTGCAGGATATGGATGG + Intergenic
1183945949 22:41325796-41325818 GCTCTGGTGCAGTACATGGAAGG + Exonic
949822095 3:8126500-8126522 TCTCTTTTGCAGCACAAGGAAGG + Intergenic
950099489 3:10348209-10348231 GGTGGTTTGCATGTCATGGAGGG - Intronic
950559604 3:13714040-13714062 GGGCTTTTGGAGGAACTGGAGGG + Intergenic
950764757 3:15265562-15265584 GGTCTCTTCCAGGAGCTGGAGGG - Intronic
952815451 3:37443295-37443317 GAAATTTTGCAGGAAATGGAAGG - Intergenic
955125694 3:56109324-56109346 TGTCTTTTGTGGAACATGGATGG - Intronic
956687811 3:71847400-71847422 TATCATTTGCAGGAGATGGAGGG - Intergenic
957221061 3:77382721-77382743 CGTCTTTTGCAGCAAATGGATGG - Intronic
957437630 3:80199553-80199575 GCTCTCTTGCAGCACCTGGATGG + Intergenic
959773740 3:110132074-110132096 TGTCCTTTGCAGGACATAGATGG + Intergenic
960327576 3:116316363-116316385 GATATTTTGCTAGACATGGAGGG - Intronic
961385137 3:126518862-126518884 GCCCTTTTGCAGCACAGGGAGGG + Intergenic
961955592 3:130799691-130799713 GCACTTTTGCAGGCCATGGCGGG + Intergenic
962089391 3:132227327-132227349 TGTCCTTTGCAGGGAATGGAGGG - Intronic
963532545 3:146489006-146489028 TGTCCTTTGCAGGACATGGATGG + Intronic
963747381 3:149138513-149138535 TGTAATTTGGAGGACATGGATGG + Intronic
964104525 3:153024603-153024625 GGTGTTCTGCAGGCCATGGCGGG + Intergenic
965295383 3:166938716-166938738 TGTTTTTTGCAGAACATGTATGG - Intergenic
965989265 3:174796526-174796548 TGTCTTTAGCACAACATGGATGG - Intronic
965993851 3:174854218-174854240 TATCTTTTGCAGTACATGGATGG + Intronic
966654800 3:182343833-182343855 TGTTCTTTGCAGCACATGGATGG - Intergenic
967696563 3:192538686-192538708 GGTATTTTGAAGGACTTGCATGG + Intronic
967787605 3:193514384-193514406 TGTCCTTTTCAGGACATGGATGG - Intronic
968909271 4:3469360-3469382 AGGCTTTTGCAGAACTTGGAGGG - Intronic
969082570 4:4630667-4630689 TGTCCCCTGCAGGACATGGATGG + Intergenic
971402598 4:26290081-26290103 GGACTTTGGGAGGACATGGTGGG + Intronic
971620199 4:28845786-28845808 TGTTCTTTGCAGGACATGGATGG - Intergenic
972213176 4:36863092-36863114 TGTCTTTTGCACAACTTGGATGG + Intergenic
972984854 4:44750733-44750755 TGTCCTTTCCGGGACATGGATGG - Intergenic
974483153 4:62471772-62471794 GTTCTTTTCAGGGACATGGATGG - Intergenic
974986806 4:69037463-69037485 TGTATTTTACAGGACATAGATGG - Intronic
975748891 4:77502276-77502298 GGTGTTCTGCAGGACAGGGACGG + Intergenic
976793270 4:88904456-88904478 TGTCCTTTCTAGGACATGGATGG + Intronic
977520153 4:98072248-98072270 TGTCCTTTGCGGGACATGAATGG + Intronic
978514953 4:109560021-109560043 GGTCTTCTGCTGGAGAAGGAGGG + Intergenic
979300801 4:119085124-119085146 TGTCTTTTGCAGTAAATGGTTGG + Intergenic
980857486 4:138456601-138456623 TGTGCTGTGCAGGACATGGATGG + Intergenic
982601994 4:157463464-157463486 GTTCTTTGCAAGGACATGGATGG + Intergenic
982948629 4:161660775-161660797 GTTCTTTGCCAGGACATGGATGG - Intronic
983081223 4:163387534-163387556 GGTCTTCTTCCGGGCATGGAGGG + Intergenic
983275091 4:165607117-165607139 GTTCTTTGCAAGGACATGGATGG - Intergenic
983419459 4:167499643-167499665 TTTTTTTTGCAGGACATGGATGG - Intergenic
984621549 4:181958672-181958694 GGTGGTTTGAAGGACATGGGAGG - Intergenic
984628016 4:182030384-182030406 TGTCTTTTGCAGGACAGGGATGG - Intergenic
986759604 5:10868200-10868222 ACTCTCTTGCAGGAGATGGAAGG + Intergenic
987003098 5:13681314-13681336 GTTCTTTTCCAGTTCATGGATGG + Intergenic
988835265 5:35025845-35025867 GGTCTTTTGCAGGGTGTGAATGG - Exonic
989693804 5:44175850-44175872 GGCCTTTGCAAGGACATGGATGG + Intergenic
989826257 5:45859907-45859929 GTCCTTTTTCAGAACATGGATGG + Intergenic
993071139 5:83165787-83165809 TGTCCTTTGCAGGACATGGATGG - Intronic
993169175 5:84394913-84394935 AGTCTTATGGAGGAAATGGATGG + Intergenic
993247684 5:85471655-85471677 TGTCCTTTGCAAAACATGGATGG + Intergenic
993286581 5:86006967-86006989 GTTCTTTGCAAGGACATGGATGG - Intergenic
993568689 5:89508562-89508584 TGTCTTTTGCGGAACATGGATGG + Intergenic
993770578 5:91919498-91919520 GGTTTCTAGCAGGCCATGGATGG + Intergenic
993820605 5:92611011-92611033 TATCCTTTGCAGGACATGGATGG + Intergenic
993889903 5:93461172-93461194 TGTCCTTTGCAAGACATGGATGG + Intergenic
994543291 5:101128142-101128164 CGTCCTTTGCAGGGCATGGATGG + Intergenic
994971426 5:106744526-106744548 TGTCTTCTATAGGACATGGATGG + Intergenic
995059044 5:107794179-107794201 TGTCCTTTGCAAAACATGGATGG + Intergenic
995357641 5:111257835-111257857 TGTCCTTCGCAGGACATGGATGG + Intronic
995621904 5:114034868-114034890 TGTTCTTTGCAGAACATGGATGG - Intergenic
996475437 5:123914534-123914556 TGTCTTTGCCAGGACATGCATGG + Intergenic
996951925 5:129137364-129137386 TGTCTTTGCAAGGACATGGATGG + Intergenic
997334629 5:133098213-133098235 TGTCTTTTGCAGCAACTGGATGG - Intronic
997785989 5:136714456-136714478 TGTCCTTTGCAGAAAATGGATGG - Intergenic
998046909 5:138995012-138995034 TGTCCTTTGCAGGACATGAATGG - Intronic
998415756 5:141945160-141945182 AGTCTTTTGGAGGACAGGGACGG - Exonic
998508805 5:142694592-142694614 GGTGTTTGGCAGGATTTGGAAGG - Intronic
998604717 5:143621948-143621970 TGTCTTTTGCAGAACATGGATGG + Intergenic
1000189600 5:158897255-158897277 TGTCCTTTGCGGGACATGGATGG + Intronic
1000588463 5:163129143-163129165 TGTCCTTTGCAGAACATGGATGG + Intergenic
1000640271 5:163694237-163694259 GTCCTTTGCCAGGACATGGATGG + Intergenic
1000668121 5:164024329-164024351 TGTCCTTTGCAGGAACTGGATGG - Intergenic
1000845814 5:166279220-166279242 GTCCTTTGCCAGGACATGGACGG - Intergenic
1001448862 5:171808654-171808676 TGTCCTTTGCAGAACGTGGATGG + Intergenic
1001548373 5:172584584-172584606 GGTCTTTAGGAGGGCATGGCAGG + Intergenic
1002086779 5:176780843-176780865 GGTTTCTGGCAGGAGATGGAAGG - Intergenic
1202774428 5_GL000208v1_random:53676-53698 GGACTTTTGGAGCACATTGAGGG - Intergenic
1002967748 6:1984058-1984080 TGTCCTTTGTGGGACATGGATGG + Intronic
1003419351 6:5941780-5941802 GCTCTGTTGCAGGACAGGTATGG - Intergenic
1004139368 6:13001532-13001554 GGGCTGTTGCAGGTCATGGTGGG - Intronic
1005678007 6:28175989-28176011 GCACTTTGGCAGGCCATGGAAGG - Intergenic
1005894359 6:30164848-30164870 GGTCTTTAGCAAGACATTCAAGG + Intronic
1005919240 6:30384100-30384122 TGTCCTTTGCGGAACATGGATGG - Intergenic
1006013836 6:31064952-31064974 GGACTTTTGGAGGACAAGGTGGG + Intergenic
1006513417 6:34533494-34533516 GGTTTTTGGATGGACATGGAGGG - Exonic
1006933625 6:37702417-37702439 GGTCTTGTGCAGAGCAGGGAAGG + Intergenic
1008098064 6:47360470-47360492 TGTCTTTTGAAGGAATTGGAAGG - Intergenic
1008208558 6:48692786-48692808 TGTCCTTTGCAGGACATAGATGG + Intergenic
1008304288 6:49882721-49882743 GTTCTTTACAAGGACATGGATGG - Intergenic
1008670403 6:53762290-53762312 CGTCTTTTGCAGCACTTGGATGG - Intergenic
1010739381 6:79482229-79482251 GGTCTTGTGCAGGGAAAGGATGG - Intergenic
1012045345 6:94265348-94265370 GGTCTCTCCCAGGACATGCAGGG + Intergenic
1012155840 6:95819285-95819307 AGAGTTTTGCAGGAGATGGAGGG - Intergenic
1013563064 6:111326072-111326094 CGTCATTTGCAAAACATGGATGG - Intronic
1013944944 6:115711339-115711361 GTTCTTTAGCAGGACATGTTTGG - Intergenic
1014012775 6:116495317-116495339 TGTCATTTGCAAAACATGGATGG - Intronic
1014367731 6:120564996-120565018 GTTCTTTTCAGGGACATGGATGG + Intergenic
1014375300 6:120664774-120664796 TGTCCTTTGCAGGGCATGGATGG - Intergenic
1015463159 6:133516818-133516840 GTCCTTTGCCAGGACATGGATGG - Intronic
1016156338 6:140813670-140813692 GTCCTTTTCAAGGACATGGATGG - Intergenic
1016273287 6:142315877-142315899 GTTCTTTGGCAGCACATGGATGG + Intronic
1017942184 6:159062708-159062730 GGGCTTTGGCAGGAAATGGTTGG - Intergenic
1018445663 6:163855861-163855883 GGTCCTTTGCAGCCCAAGGAAGG - Intergenic
1019098427 6:169607465-169607487 TGTCTTTTGCAGCACATGGATGG + Intronic
1021364247 7:19756750-19756772 GGTCTTTTGCAGGACATGGATGG - Intronic
1023269166 7:38441943-38441965 GTTCTTTGCAAGGACATGGATGG + Intronic
1025909120 7:65813243-65813265 GCTCTTTTGTAGGACAGGGATGG - Intergenic
1025979857 7:66396471-66396493 GCTCTTTTTTAGGACAGGGAGGG + Intronic
1026043681 7:66889802-66889824 GCTCTTTTTTAGGACAGGGAGGG - Intergenic
1026539378 7:71267052-71267074 GGGCTTTTGCATGTCAGGGAAGG - Intronic
1027382298 7:77624012-77624034 GCTCTTTGGGAGGACATGGCAGG + Intronic
1028170354 7:87588484-87588506 CGTCCTTTGCAGGGCATGGCTGG - Intronic
1029294089 7:99525676-99525698 GGACTTTTACAGTACAGGGATGG - Intronic
1030191399 7:106813861-106813883 GGTCTTTTGCACCAGAAGGATGG - Intergenic
1030376829 7:108762165-108762187 GTTCTTTTCAGGGACATGGATGG + Intergenic
1031404204 7:121363987-121364009 GATTTTTTGCAGGGCAGGGATGG + Intronic
1031873210 7:127109882-127109904 GGTCTTTGGCAGGATAGGGAAGG - Intronic
1032648559 7:133853167-133853189 ATTCTTTAGCATGACATGGAGGG + Intronic
1032802320 7:135326943-135326965 GGTCTTTTACTGGACAAGCAGGG + Intergenic
1033745850 7:144316637-144316659 TGTCCTTTGATGGACATGGATGG - Intergenic
1035600922 8:896322-896344 GGTTTTGTGCAGGACCTGGCCGG + Intergenic
1037268298 8:17094010-17094032 TATCTTTTGAAGGACATTGAGGG - Intronic
1038992838 8:32888186-32888208 GGTCTATTGAATTACATGGATGG + Intergenic
1039931232 8:41991511-41991533 GTTCTCTTTCAGGACCTGGATGG + Intronic
1040496535 8:47970525-47970547 GCTCTTTGGCGGGACAAGGAAGG + Exonic
1040834387 8:51717392-51717414 GTTCTTTTGCAAGACATCTATGG - Intronic
1041404963 8:57488180-57488202 GTTTTTTTGTTGGACATGGATGG + Intergenic
1041572043 8:59348747-59348769 TGTCCTTTGCAGAACATGGATGG + Intergenic
1043325044 8:79039759-79039781 TGTCATTTGCAGGACATGATTGG + Intergenic
1045728867 8:105210500-105210522 GTTCTTTTCAGGGACATGGATGG + Intronic
1048078295 8:131097389-131097411 TGTCTTTGCAAGGACATGGATGG + Intergenic
1048109350 8:131450838-131450860 TGTCTTTTGCAGGACATGGATGG - Intergenic
1049086035 8:140479313-140479335 TGTCTTTTCAGGGACATGGATGG + Intergenic
1050804030 9:9651545-9651567 TGTCCTTTGCAGGACATGGATGG - Intronic
1050924386 9:11245130-11245152 GTCCTTTTGAGGGACATGGATGG - Intergenic
1051405389 9:16732143-16732165 TTTTTTTTGCAGGAAATGGAGGG - Intronic
1052618782 9:30878104-30878126 TGTCCTTTGCAGAACATGGATGG - Intergenic
1056485337 9:87051301-87051323 TGTCTTTTGCAGAGCATGGATGG + Intergenic
1056844702 9:90027133-90027155 TGTGATTTGCAGGACATAGAAGG - Intergenic
1057348277 9:94271835-94271857 GGACTTTTGCAGGAAGTGTATGG + Intronic
1058406463 9:104681056-104681078 TGTCATTTGCACAACATGGATGG + Intergenic
1058549369 9:106097549-106097571 TGTCCTTTGCAGGACATGGATGG + Intergenic
1059831700 9:118103394-118103416 TGTCCTTTGCAGGGCATGGGTGG + Intergenic
1061185057 9:129048231-129048253 GGTCATGAGCAGGACATGGAGGG + Intronic
1203418191 Un_KI270366v1:4438-4460 GGACTTTTGGAGCACATTGAGGG - Intergenic
1186051300 X:5598504-5598526 CGTCTTTTGCAGAACATGGATGG - Intergenic
1186115694 X:6303181-6303203 TGTCTTTTCAGGGACATGGATGG - Intergenic
1187345684 X:18461443-18461465 GGTCTTTTGAATGATATGGTAGG - Intronic
1187640241 X:21279763-21279785 TGTCTTTTGCAGGACATGAATGG - Intergenic
1187640561 X:21284263-21284285 TGTCCTTGGCAGGACGTGGATGG + Intergenic
1187724560 X:22189082-22189104 TGTCATTTGCAACACATGGATGG - Intronic
1188090620 X:25960196-25960218 TTTCTTTTGCAGGGCATGGATGG - Intergenic
1188523342 X:31062307-31062329 GATCTTTTGCAGGGCATTGTTGG - Intergenic
1188698074 X:33222010-33222032 ATTCTTTTCCAGAACATGGAAGG + Intronic
1188909176 X:35824296-35824318 TGTCTTTTGTAGAATATGGATGG - Intergenic
1188952844 X:36397599-36397621 GGTCTTTGCAGGGACATGGATGG - Intergenic
1191026762 X:55922302-55922324 TGTCCTTTGTAGGACATGGATGG + Intergenic
1191894486 X:65977334-65977356 GTCCTTTTCCGGGACATGGATGG - Intergenic
1192742829 X:73910157-73910179 GGTCTTTTGATTGAAATGGAAGG - Intergenic
1193012618 X:76694429-76694451 GCTCTTTGGCAGGCCAAGGAGGG - Intergenic
1193158297 X:78198624-78198646 GGTTTTTTTCAGGACAGAGAAGG + Intergenic
1194172585 X:90605807-90605829 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1194918294 X:99731629-99731651 GTTCTTTGCAAGGACATGGATGG + Intergenic
1196486568 X:116217303-116217325 TGTCTTTTGCAGAACATGGATGG + Intergenic
1196643035 X:118085736-118085758 TGTCTTTTGCAGCAATTGGATGG - Intronic
1198840701 X:140854264-140854286 GGTGTTTTCCAGGAAATGAAAGG + Intergenic
1198998341 X:142602866-142602888 TGTCCTTTGCAGAACATGGATGG - Intergenic
1199034704 X:143036061-143036083 GGCATTTTCCAGAACATGGATGG - Intergenic
1200518812 Y:4183544-4183566 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1201336343 Y:12884497-12884519 TGTTTTTTGCAGCAAATGGATGG - Intergenic
1201537193 Y:15063406-15063428 TGTAGCTTGCAGGACATGGATGG - Intergenic
1202275668 Y:23117094-23117116 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202290360 Y:23303597-23303619 TGTCTTTTGCAGGAAGTGGATGG - Intergenic
1202428660 Y:24750813-24750835 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202442131 Y:24919276-24919298 TGTCTTTTGCAGGAAGTGGATGG - Intergenic