ID: 1021371506

View in Genome Browser
Species Human (GRCh38)
Location 7:19854293-19854315
Sequence TAAATTTGAGGGTGTTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021371506_1021371509 27 Left 1021371506 7:19854293-19854315 CCAGGGCAACACCCTCAAATTTA No data
Right 1021371509 7:19854343-19854365 AGCAGCAACCTCATGATGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021371506 Original CRISPR TAAATTTGAGGGTGTTGCCC TGG (reversed) Intergenic
No off target data available for this crispr