ID: 1021377422

View in Genome Browser
Species Human (GRCh38)
Location 7:19925014-19925036
Sequence TTTTATATTAAAAAGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021377419_1021377422 -4 Left 1021377419 7:19924995-19925017 CCCAGAGAACAAGTGAAAATTTT No data
Right 1021377422 7:19925014-19925036 TTTTATATTAAAAAGGAGAATGG No data
1021377420_1021377422 -5 Left 1021377420 7:19924996-19925018 CCAGAGAACAAGTGAAAATTTTA No data
Right 1021377422 7:19925014-19925036 TTTTATATTAAAAAGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021377422 Original CRISPR TTTTATATTAAAAAGGAGAA TGG Intergenic
No off target data available for this crispr