ID: 1021377595

View in Genome Browser
Species Human (GRCh38)
Location 7:19927125-19927147
Sequence CAGGTTTACTAGAGGCAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021377592_1021377595 -3 Left 1021377592 7:19927105-19927127 CCAAAGCGCTTGGTCGCTTACAG No data
Right 1021377595 7:19927125-19927147 CAGGTTTACTAGAGGCAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021377595 Original CRISPR CAGGTTTACTAGAGGCAAGT AGG Intergenic
No off target data available for this crispr