ID: 1021387586

View in Genome Browser
Species Human (GRCh38)
Location 7:20050798-20050820
Sequence GCTGAGAGGCAGACTGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021387586_1021387588 18 Left 1021387586 7:20050798-20050820 CCTTCTACAGTCTGCCTCTCAGC No data
Right 1021387588 7:20050839-20050861 TTAAAGTGTAAGTCAGATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021387586 Original CRISPR GCTGAGAGGCAGACTGTAGA AGG (reversed) Intergenic
No off target data available for this crispr