ID: 1021391858

View in Genome Browser
Species Human (GRCh38)
Location 7:20102641-20102663
Sequence GGGTGGGACAAGATAAATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021391853_1021391858 -4 Left 1021391853 7:20102622-20102644 CCTGACTGGCTCAAACCATGGGT No data
Right 1021391858 7:20102641-20102663 GGGTGGGACAAGATAAATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021391858 Original CRISPR GGGTGGGACAAGATAAATTA GGG Intergenic
No off target data available for this crispr