ID: 1021393271

View in Genome Browser
Species Human (GRCh38)
Location 7:20120634-20120656
Sequence GTTTAAGGAGCTGTGGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021393271_1021393274 -6 Left 1021393271 7:20120634-20120656 CCTGGGGCCACAGCTCCTTAAAC No data
Right 1021393274 7:20120651-20120673 TTAAACTAACACAAAAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021393271 Original CRISPR GTTTAAGGAGCTGTGGCCCC AGG (reversed) Intergenic
No off target data available for this crispr