ID: 1021395212

View in Genome Browser
Species Human (GRCh38)
Location 7:20139129-20139151
Sequence ACACAGCCTCAAAGAAATGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10282
Summary {0: 2, 1: 2, 2: 154, 3: 4646, 4: 5478}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021395212_1021395215 20 Left 1021395212 7:20139129-20139151 CCCACATTTCTTTGAGGCTGTGT 0: 2
1: 2
2: 154
3: 4646
4: 5478
Right 1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG 0: 1
1: 0
2: 0
3: 4
4: 62
1021395212_1021395214 9 Left 1021395212 7:20139129-20139151 CCCACATTTCTTTGAGGCTGTGT 0: 2
1: 2
2: 154
3: 4646
4: 5478
Right 1021395214 7:20139161-20139183 CTAAATTCTAGCAGCCTTAATGG 0: 1
1: 0
2: 3
3: 9
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021395212 Original CRISPR ACACAGCCTCAAAGAAATGT GGG (reversed) Exonic
Too many off-targets to display for this crispr