ID: 1021395213

View in Genome Browser
Species Human (GRCh38)
Location 7:20139130-20139152
Sequence CACACAGCCTCAAAGAAATG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5412
Summary {0: 1, 1: 1, 2: 5, 3: 210, 4: 5195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021395213_1021395215 19 Left 1021395213 7:20139130-20139152 CCACATTTCTTTGAGGCTGTGTG 0: 1
1: 1
2: 5
3: 210
4: 5195
Right 1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG 0: 1
1: 0
2: 0
3: 4
4: 62
1021395213_1021395214 8 Left 1021395213 7:20139130-20139152 CCACATTTCTTTGAGGCTGTGTG 0: 1
1: 1
2: 5
3: 210
4: 5195
Right 1021395214 7:20139161-20139183 CTAAATTCTAGCAGCCTTAATGG 0: 1
1: 0
2: 3
3: 9
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021395213 Original CRISPR CACACAGCCTCAAAGAAATG TGG (reversed) Exonic
Too many off-targets to display for this crispr