ID: 1021395215

View in Genome Browser
Species Human (GRCh38)
Location 7:20139172-20139194
Sequence CAGCCTTAATGGCCCTAATG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 62}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021395213_1021395215 19 Left 1021395213 7:20139130-20139152 CCACATTTCTTTGAGGCTGTGTG 0: 1
1: 1
2: 5
3: 210
4: 5195
Right 1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG 0: 1
1: 0
2: 0
3: 4
4: 62
1021395212_1021395215 20 Left 1021395212 7:20139129-20139151 CCCACATTTCTTTGAGGCTGTGT 0: 2
1: 2
2: 154
3: 4646
4: 5478
Right 1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG 0: 1
1: 0
2: 0
3: 4
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021395215 Original CRISPR CAGCCTTAATGGCCCTAATG TGG Exonic
901142468 1:7044029-7044051 CAGCCCTAATGGCCCTCTGGAGG - Intronic
901635711 1:10669262-10669284 CCGGCTTAGGGGCCCTAATGGGG - Intronic
903368523 1:22819482-22819504 GTGACTTAATGGCCCTACTGGGG - Intronic
905110396 1:35590447-35590469 CAACCCTAATGGCCCCAAGGTGG + Intronic
907710477 1:56876105-56876127 CTGCCTTGATGGCTCTGATGAGG + Exonic
908302121 1:62772641-62772663 AAGACTTATTGGCCCTAAAGAGG - Intergenic
908811255 1:67984325-67984347 TACCCTTAAGGGCCCTAGTGTGG - Intergenic
912679491 1:111720138-111720160 CAGACTCAATGTCCCTAGTGGGG + Intronic
913253783 1:116935878-116935900 CAGCCTTAAAAGTCCTATTGAGG - Intronic
919968429 1:202553284-202553306 CAGCTTTTATGGCCCAACTGGGG - Intronic
920665228 1:207958813-207958835 CAGCCTTAATCGCAGTAAGGGGG + Intergenic
1063967996 10:11361928-11361950 CAGCATTAATGGCATCAATGTGG - Intergenic
1066730139 10:38429608-38429630 CAGCCTTAATAGACCTAGTTGGG + Intergenic
1072324398 10:94282974-94282996 CAGCCTGCATGGCCCTGATTTGG + Intronic
1091135042 11:133180724-133180746 CAGCCTTCACAGCCTTAATGAGG - Intronic
1092666768 12:10809376-10809398 CTGCCTTTATGGCCCTCATGTGG + Exonic
1096491137 12:52013700-52013722 CAGCGTCAATGGCCTGAATGTGG + Exonic
1097904696 12:64907682-64907704 CAGGCTTATTGGACCTAAGGTGG - Intergenic
1115269593 14:31537057-31537079 CAGTATCTATGGCCCTAATGGGG + Intronic
1121615029 14:95307977-95307999 CAGCCTTAAATGACATAATGGGG + Intronic
1126250631 15:46564269-46564291 AAGCATTATTGGCCCTAAAGAGG - Intergenic
1131351497 15:91704919-91704941 CAGCTTTAATGGCCTCATTGTGG + Intergenic
1134506262 16:14809957-14809979 GAGCCTTTATGGCCCTCATAAGG + Intronic
1134574290 16:15318807-15318829 GAGCCTTTATGGCCCTCATAAGG - Intergenic
1148766087 17:50039132-50039154 CAGCCTGACTGGCCCTGATCAGG + Intergenic
1152590308 17:81208455-81208477 CTGCCTCAATGGCCCCAGTGGGG - Intronic
1153210956 18:2763687-2763709 CACCATTAAAGGCTCTAATGAGG + Exonic
1155282314 18:24252102-24252124 CAGTGTTACTGGCCCTAAAGAGG + Intronic
1164927835 19:32144109-32144131 CATCCTTAAATGTCCTAATGAGG + Intergenic
930277639 2:49332075-49332097 CAGTCTTATTGGCCCAAATTTGG + Intergenic
930981088 2:57527174-57527196 AAGAGTTATTGGCCCTAATGAGG - Intergenic
932457198 2:71857408-71857430 CAGCCCTAATGGCCCTCAGTGGG + Intergenic
932878067 2:75474017-75474039 AAGCCTTAATGTCATTAATGAGG + Intronic
933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG + Intronic
937099761 2:119259740-119259762 CAGCCTTAGTAGCCCCAGTGAGG - Intronic
938177779 2:129151974-129151996 AAGCATTAATGGCCTTAAAGAGG - Intergenic
945175779 2:207041708-207041730 CAGCCTCAATGGGCTGAATGTGG + Intergenic
945507746 2:210662296-210662318 CAATCTTAATAGCCCTAGTGAGG + Intronic
1171215320 20:23348391-23348413 CAGGCTCAGTGGCCCTAATTGGG + Intergenic
1174431816 20:50475601-50475623 CTCCCTTAATGGCACAAATGGGG + Intergenic
1175489010 20:59366009-59366031 CAGCCGTAATGGCACTATTAAGG + Intergenic
1178639620 21:34335551-34335573 CTCCCCTGATGGCCCTAATGAGG - Intergenic
961512560 3:127412033-127412055 CAGCCCTAACAGCCCTAAGGCGG + Intergenic
966829562 3:183995251-183995273 CTGCATGAATGGCCCTAATTAGG - Intronic
968058633 3:195712016-195712038 CAGACTTAAGGGCAGTAATGTGG - Intergenic
979006043 4:115298521-115298543 CAGCCTTAATGGCTCACTTGAGG - Intergenic
992106400 5:73451826-73451848 CAGCCTTCATCCCCCTAAGGAGG - Intergenic
994087875 5:95780147-95780169 CAGCCTAGCTGTCCCTAATGTGG + Intronic
996571277 5:124934727-124934749 CAGCCTTAATGCCCCAAATTAGG + Intergenic
1000255603 5:159535337-159535359 CAGCCCAAATGGTTCTAATGTGG - Intergenic
1001013571 5:168120173-168120195 CAGCAGTAATGCCCTTAATGGGG + Intronic
1005438203 6:25837391-25837413 CAGCCATTGTGGCCCTGATGGGG + Intronic
1010190248 6:73187953-73187975 CTGCCTTTTTTGCCCTAATGGGG - Intronic
1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG + Exonic
1022802308 7:33788198-33788220 CAGCCTTCATGGCTCTAATTGGG - Intergenic
1024036125 7:45509063-45509085 CAGCCTCAATGGCCCACATGGGG - Intergenic
1025054548 7:55754314-55754336 TAGCCTTAATGGACCTAGTTTGG - Intergenic
1028832168 7:95340256-95340278 CAGCCCTAGTGGACCTAACGTGG + Intergenic
1031919972 7:127593329-127593351 CAGCTTTTATGGCCCTTAGGAGG - Intronic
1049834217 8:144723428-144723450 CAGGCATAATGTCCATAATGTGG + Intronic
1057372894 9:94490120-94490142 TAGCCTTAATGGACCTATTTTGG + Intergenic
1190911857 X:54778663-54778685 AAGAGTTAGTGGCCCTAATGAGG + Intronic
1195506230 X:105659908-105659930 AAGACTTATTGGCCCTAAAGAGG + Intronic
1199665419 X:150092785-150092807 CAGTCATAATGGCCCTCAAGAGG + Intergenic
1200272649 X:154700424-154700446 CAGCATTAAGGGCCCAATTGAGG + Intronic
1202304240 Y:23451257-23451279 CAGCTTTTATGGCCCAACTGGGG - Intergenic
1202566570 Y:26219334-26219356 CAGCTTTTATGGCCCAACTGGGG + Intergenic