ID: 1021395215

View in Genome Browser
Species Human (GRCh38)
Location 7:20139172-20139194
Sequence CAGCCTTAATGGCCCTAATG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 62}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021395213_1021395215 19 Left 1021395213 7:20139130-20139152 CCACATTTCTTTGAGGCTGTGTG 0: 1
1: 1
2: 5
3: 210
4: 5195
Right 1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG 0: 1
1: 0
2: 0
3: 4
4: 62
1021395212_1021395215 20 Left 1021395212 7:20139129-20139151 CCCACATTTCTTTGAGGCTGTGT 0: 2
1: 2
2: 154
3: 4646
4: 5478
Right 1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG 0: 1
1: 0
2: 0
3: 4
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021395215 Original CRISPR CAGCCTTAATGGCCCTAATG TGG Exonic