ID: 1021397367

View in Genome Browser
Species Human (GRCh38)
Location 7:20166825-20166847
Sequence CACTGGCAGAACTGAAGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021397363_1021397367 24 Left 1021397363 7:20166778-20166800 CCAGGTCAAGATGTCTATCACTT 0: 1
1: 0
2: 4
3: 6
4: 97
Right 1021397367 7:20166825-20166847 CACTGGCAGAACTGAAGTTCAGG 0: 1
1: 0
2: 3
3: 21
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021397367 Original CRISPR CACTGGCAGAACTGAAGTTC AGG Intronic
902395748 1:16131801-16131823 CGCTGGCAGAGGTGAACTTCCGG + Exonic
902397011 1:16137871-16137893 CACTGGCAGTACGGAAGCTGCGG + Exonic
902968853 1:20032083-20032105 CAATGGGAGAAGTGAAGTTCAGG + Intronic
903382881 1:22909069-22909091 CACTGGCCGAGGTGAACTTCCGG - Exonic
903755802 1:25659654-25659676 CACTGGCAAAGCTGGAGTCCAGG - Intronic
904907776 1:33910836-33910858 CACTGCCTGAAGTCAAGTTCTGG + Intronic
906199093 1:43947711-43947733 CAGTGACAGAGCAGAAGTTCTGG + Intronic
908293900 1:62694020-62694042 CAGTGTCAGAACTGAACTTCAGG - Intergenic
908445708 1:64197500-64197522 CAGTGGAAGAACTGAAGATGGGG + Intergenic
909206057 1:72759244-72759266 GACTGGGAGAACTGAAGTGTGGG - Intergenic
913330823 1:117665985-117666007 AGGTGGCAGAAGTGAAGTTCTGG - Intergenic
914384311 1:147153035-147153057 CACTAGATGAACTAAAGTTCAGG - Intergenic
917679180 1:177348855-177348877 AAATAGCAAAACTGAAGTTCAGG + Intergenic
917898606 1:179517708-179517730 CACTGGGGAAACTGAAGGTCTGG - Intronic
918926698 1:190795615-190795637 TACTGGCAGCACTTAAGTTTAGG + Intergenic
920058763 1:203213360-203213382 CACAGGCAGAAGTGAAGCACAGG + Intronic
920707489 1:208264965-208264987 CACTGGCAGAAGTGCAGCTTGGG + Intergenic
923486299 1:234434703-234434725 CCCTGGCAGAACTGAAGCTGGGG + Intronic
923763348 1:236868985-236869007 CACTGGCACTACTTAAGTACAGG + Intronic
923823871 1:237477497-237477519 CAGGGACAGAACTGAAGTTTTGG + Intronic
924725479 1:246665868-246665890 GAGTGGCAGAACTGAAGCACTGG + Exonic
1063256591 10:4334629-4334651 CACTAGCAGAGATGAAGTTTGGG + Intergenic
1066960376 10:42217158-42217180 CACTGGCCGAGGTGAAGTCCGGG + Intergenic
1068864800 10:61883631-61883653 CAATGACAGAACTGATGATCTGG - Intergenic
1070700532 10:78598530-78598552 CACTGGCTGGACTGGAGTTAAGG + Intergenic
1072176989 10:92936250-92936272 CACAGGCAGAACAGAAACTCTGG - Intronic
1073089342 10:100921289-100921311 CACTTGCAGCACTGAACTCCTGG + Intronic
1074902544 10:117831415-117831437 CACTGAAAGACATGAAGTTCAGG + Intergenic
1076236123 10:128864865-128864887 CCCTGGTACAACTGCAGTTCTGG + Intergenic
1077966691 11:7141644-7141666 AATTGGCTGGACTGAAGTTCAGG - Intergenic
1077999296 11:7480556-7480578 CACTGTCACAACTCTAGTTCTGG + Intergenic
1080350706 11:31382764-31382786 CAGTGTCAGAACTGAATTACAGG - Intronic
1083342756 11:61968756-61968778 CGGTGGAAGAACTGAATTTCAGG + Intergenic
1083685976 11:64375385-64375407 TACTGTTAGAACTAAAGTTCTGG + Intergenic
1084537135 11:69763917-69763939 CAATGGCAGGAATGAGGTTCTGG + Intergenic
1085419350 11:76342234-76342256 CCATGGGAGAACTGAATTTCAGG - Intergenic
1085731426 11:79002226-79002248 CACTGGCAGGAGTGAGGTGCTGG - Intronic
1085756445 11:79205975-79205997 CACTGGCAGGTCTGGTGTTCAGG + Intronic
1087307701 11:96504657-96504679 CAATGGGAGAAGTGAAGTCCAGG - Intronic
1088720457 11:112587784-112587806 CTCTGACAGAGGTGAAGTTCCGG + Intergenic
1089676092 11:120090686-120090708 CACTGGCAGAGCCAAAGTTCAGG - Intergenic
1090234623 11:125138575-125138597 CACTGGCAGAGATGAAGTTTTGG + Intergenic
1090392550 11:126398519-126398541 CACTGGTAGCTCTGCAGTTCTGG + Intronic
1090859583 11:130640887-130640909 AATTGACAGCACTGAAGTTCAGG - Intergenic
1091145227 11:133273529-133273551 CTCTCGCAGAACCAAAGTTCAGG + Intronic
1093154819 12:15669400-15669422 CACTGGAAGAGATGAAGATCTGG + Exonic
1094306766 12:29028859-29028881 GAATGGAAGAACTGAAGTTAGGG - Intergenic
1095842629 12:46710588-46710610 CACTGGCAGACCTGAGGCTGAGG + Intergenic
1098358822 12:69635599-69635621 CATTGGTAGAACTGAAATACAGG + Intergenic
1102737214 12:115173082-115173104 CTTTGGCTGAACTGAGGTTCAGG + Intergenic
1103314011 12:120036995-120037017 AACTGACAGAACTTAAGTTCTGG - Intronic
1104212748 12:126705664-126705686 AAATGGCAGCACTGCAGTTCAGG - Intergenic
1109094022 13:58088160-58088182 CACTGTCATATCAGAAGTTCAGG - Intergenic
1109489683 13:63080544-63080566 CTCTGGCAGAAGTGATTTTCTGG + Intergenic
1109775767 13:67039284-67039306 CACAGGCAGAACCTAAGTACCGG + Intronic
1110046371 13:70837931-70837953 CACTAGCAGAACTGTACTACAGG - Intergenic
1112508940 13:99991561-99991583 GACTGGCAGAACTGGAGGTGTGG + Intergenic
1112659756 13:101494297-101494319 CACCTGCAGCACTGAAGTTTTGG + Intronic
1112721894 13:102254822-102254844 CACTGACATAGCTGAAGTCCTGG + Intronic
1113657318 13:112075323-112075345 CACTCTCACCACTGAAGTTCAGG - Intergenic
1113785424 13:112999895-112999917 CACAGGCAGGGCTGAAGTGCGGG + Intronic
1114266894 14:21077986-21078008 CAGTTGAGGAACTGAAGTTCAGG + Intronic
1115534513 14:34360142-34360164 CTATGCCAGAAATGAAGTTCTGG + Intronic
1121249635 14:92489928-92489950 CACTGACAGACCAGAAGTCCAGG + Intronic
1122832532 14:104407073-104407095 CTCTGCCAGAACTGAGGTGCCGG - Intergenic
1123890579 15:24774332-24774354 CACTGGGAGAACACAAGATCTGG + Intergenic
1124460071 15:29881497-29881519 CACTGGCAGAATTTAAACTCAGG - Intronic
1126890780 15:53201960-53201982 CAGTGGTAGAACAGAAATTCTGG + Intergenic
1130227310 15:82069042-82069064 CACTGGCAGAACAGCAGCCCTGG - Intergenic
1131601682 15:93855617-93855639 CTGTGGGAGAACTGAAGTTTGGG - Intergenic
1133791226 16:9010829-9010851 TTTTGTCAGAACTGAAGTTCAGG - Intergenic
1137641901 16:50039465-50039487 CACTCCCTGAACTGTAGTTCTGG - Intergenic
1137703838 16:50519836-50519858 CAGTGGCAGAGGTGAAGTTCTGG + Intergenic
1138607097 16:58096536-58096558 CAGAGGCAGCTCTGAAGTTCAGG + Intergenic
1139441983 16:66972931-66972953 CACGGGCCGGACAGAAGTTCAGG + Exonic
1141234300 16:82201185-82201207 CACTGGGAGAACAGAAGAGCTGG - Intergenic
1141463255 16:84190970-84190992 CACTGCCTGGACGGAAGTTCCGG - Intergenic
1145756015 17:27390531-27390553 CAGTGGCAGAACCCAACTTCTGG - Intergenic
1145944564 17:28763500-28763522 CATTGGGAGGACTGAATTTCAGG - Intronic
1146301922 17:31696176-31696198 CATTCCCAGCACTGAAGTTCGGG + Intergenic
1148241472 17:46002131-46002153 CACTGGCAGAAGAGAGGTTGGGG + Intronic
1148645553 17:49217981-49218003 AACTTGCAGAACTGGGGTTCTGG - Intronic
1149636249 17:58172299-58172321 CACTGGAAAAACTGAAATTGAGG + Intergenic
1150538842 17:66075936-66075958 CACTGGGAAAACTCAAGGTCTGG + Intronic
1152115262 17:78382556-78382578 CTGTGGCAGAACTGGAGCTCAGG + Intronic
1152267743 17:79306170-79306192 AACTGGCAGAGCTGAGGCTCAGG - Intronic
1152503694 17:80731343-80731365 CACTGGTGGAACTGAAGCTGTGG - Intronic
1153157887 18:2169529-2169551 CAGGGGCAGCTCTGAAGTTCTGG + Intergenic
1153886541 18:9473104-9473126 CACTGGCAAAACTGCAGTTCTGG + Intergenic
1153948243 18:10035569-10035591 CACTGGCCTGACTGCAGTTCCGG + Intergenic
1155963857 18:32018472-32018494 CACTGTCAGAAGTTAAGTGCGGG - Exonic
1156960151 18:43018266-43018288 CACTATTAGAACTGAAGTTTTGG + Intronic
1158978031 18:62730217-62730239 CACAGCCAGAACTCAAGTCCAGG - Intronic
1159342740 18:67158099-67158121 CACTGGGAGAAAGGAAGTTATGG - Intergenic
1166253415 19:41586264-41586286 ATCTGGCTGAGCTGAAGTTCAGG + Intronic
925743384 2:7025087-7025109 CTCTGGCAGAATGGAAGTTCTGG + Intronic
928250306 2:29671569-29671591 CACTGGAAAAACTGAAATTGAGG - Intronic
930867484 2:56136177-56136199 CACTGGCAGATTTGGAGTTCTGG + Intergenic
932599140 2:73112253-73112275 CACTGGCCCGGCTGAAGTTCGGG + Intronic
933143271 2:78820181-78820203 CACTGCCAAAACTGTAGTTCTGG - Intergenic
934033256 2:88066527-88066549 CACTTGCAGATCTGGAGCTCTGG - Intergenic
934462897 2:94230640-94230662 CACTGGCCGAGCTGAAGTCTGGG - Intergenic
935492502 2:103737269-103737291 CACTGGAACAAGTGAAGTTAAGG + Intergenic
937161591 2:119767696-119767718 CACTGGATGAACTTAAGTTGAGG - Intronic
942517196 2:176766740-176766762 CACTGGCAAAGCTGAAGCTGAGG + Intergenic
942931556 2:181500320-181500342 CCTTGACAGAACTCAAGTTCAGG - Intronic
944776560 2:202972698-202972720 CAGTGGCAGAACTGAAATTTAGG + Intronic
947159953 2:227204431-227204453 CACTGGCAGAACTATAGTAAAGG - Intronic
947578161 2:231293268-231293290 CTCAGGCAGCACTGAGGTTCAGG - Intronic
1169022179 20:2338650-2338672 CAGTGACAGAGCTGAGGTTCAGG - Intronic
1170787246 20:19478226-19478248 CCCTGGGAGAAATGAAGTGCAGG + Intronic
1171086554 20:22243425-22243447 CACTGGTAGAAATGCTGTTCTGG + Intergenic
1172601148 20:36183872-36183894 CACAGTCAGAACTGAAGTCCTGG - Intronic
1177889285 21:26785583-26785605 CACTTTCAGAACTTAAGATCTGG + Intergenic
1179604667 21:42506673-42506695 CACTAGGAAAACTGGAGTTCAGG + Intronic
1183588912 22:38768876-38768898 CACTGGGAGGACTGCAGTTGAGG - Intronic
1184466533 22:44671650-44671672 CAATGAGAGAACTGAAGCTCAGG - Intronic
949515309 3:4801988-4802010 CACTTGCAGCACTGAATTTTAGG + Intronic
950134118 3:10568541-10568563 AACAGCCAGAACTGAAGTGCAGG - Intronic
954288969 3:49638931-49638953 CACGGGAAGAACTGAATTTGTGG + Intronic
955092188 3:55763528-55763550 AGATGGCAGAACTGAAGCTCAGG - Intronic
956127907 3:66028403-66028425 AACTGGGAGAACTGATGTTCTGG + Intronic
956341200 3:68226034-68226056 CATTAGCAGAATTGAAATTCAGG + Intronic
959902615 3:111676910-111676932 CACTAGCAGAGCTGGAGTTATGG - Intronic
964630607 3:158805807-158805829 CAATGAGAGAACTGAAGCTCAGG - Intronic
964849187 3:161076617-161076639 CACTTACACAACTGCAGTTCAGG + Exonic
967196165 3:187027661-187027683 CACTGACAGAACCGACTTTCCGG + Intronic
971312648 4:25538746-25538768 CCCTGGCAGAACTTAAGGTCTGG - Intergenic
973148490 4:46859631-46859653 GACTGGCAGAACTTATTTTCTGG + Intronic
974694498 4:65348134-65348156 CACTGGCAGAAGTAAACTTTCGG + Exonic
978365495 4:107976945-107976967 CACTGGCAGACTTCAAATTCAGG - Intergenic
978526909 4:109676944-109676966 CACTGGTAGCTCTAAAGTTCTGG - Intronic
978542430 4:109832347-109832369 CACTGACAACACTGAGGTTCTGG + Intronic
979536196 4:121823461-121823483 CGCTGGCGGTACTGAAGTCCGGG - Exonic
986352522 5:6893820-6893842 CACAGGCAGATCTGAGGTACCGG + Intergenic
987275280 5:16355584-16355606 CTCTGGCAGCACTCAGGTTCTGG + Intergenic
992354309 5:75965143-75965165 CATTGTCAGAACTGCAGTTAAGG + Intergenic
993664324 5:90676854-90676876 GAATAGCAGAACTGAAGTTAAGG - Intronic
994568491 5:101483513-101483535 CACTGGGGAAACTGAAGTTCTGG - Intergenic
999264145 5:150255573-150255595 AAATGGCAGAACTGAGGTTCAGG + Intronic
999361310 5:150988839-150988861 CATTGGAAGAAGTGAAGTTCAGG + Intergenic
1000818977 5:165959995-165960017 GTTTGGCAGAACTGAAGTCCAGG + Intergenic
1000854528 5:166381671-166381693 CAGTGGCAGAAGTGAACTTTGGG - Intergenic
1001668237 5:173451293-173451315 CACTGGCAGAAATCAAGTGAAGG - Intergenic
1002647892 5:180670648-180670670 CACTTGCAGAAGTGAGGTGCTGG + Intergenic
1003130189 6:3388946-3388968 CATTTGCAGAACTGAAACTCTGG - Intronic
1006707490 6:36033654-36033676 AACTGGCAGAACTGAAAACCTGG - Intronic
1006855325 6:37129085-37129107 CTCTGGCAGCCCTGAAGCTCTGG - Intergenic
1007122827 6:39397538-39397560 GGCAGGCAGAACTCAAGTTCAGG - Intronic
1007653152 6:43435631-43435653 CAATGACAGAACTGAAGGGCTGG - Intronic
1008715013 6:54278136-54278158 CACTGACAGAACTGAAGAAATGG + Intergenic
1009490301 6:64282881-64282903 AAGAGACAGAACTGAAGTTCAGG - Intronic
1010240969 6:73615086-73615108 CAGTGTCAGAACTGAATTACAGG + Intronic
1011973152 6:93254727-93254749 CACTGGCTGATGTGAATTTCCGG + Exonic
1013288681 6:108701277-108701299 CACTGGCAGAAATGAAGTTTTGG + Intergenic
1013933935 6:115570840-115570862 CACAGGGAGAATTGAAGTGCAGG + Intergenic
1015346399 6:132164475-132164497 CAGTGGAAGAAGGGAAGTTCTGG - Intergenic
1015982648 6:138854543-138854565 CATTGGCGGGACTCAAGTTCAGG - Intronic
1017564745 6:155671378-155671400 CACTGTCAGAAGTGAAATTCAGG - Intergenic
1017838779 6:158204644-158204666 CAGTGGCAGAAAAGAAGTTGGGG - Intergenic
1021397367 7:20166825-20166847 CACTGGCAGAACTGAAGTTCAGG + Intronic
1022713228 7:32872860-32872882 AACTGGCTGAACTGGATTTCTGG + Intronic
1022949891 7:35328074-35328096 CACTTGCAGAAATGGAGTTGAGG + Intergenic
1024612599 7:51080425-51080447 CAGTGGCAGAAGAGAAGTGCAGG + Intronic
1026297533 7:69067991-69068013 CACTGTTACAACTGAAGATCGGG - Intergenic
1027550898 7:79593968-79593990 TCCTGGCAGAACTGAAGATTGGG - Intergenic
1028318782 7:89435874-89435896 CAATGGGAGAAGTGAAGTCCAGG - Intergenic
1029479981 7:100806500-100806522 CACTGGCGGAAGTGAACTTCCGG + Exonic
1029540241 7:101178522-101178544 CACTGTCAGAAATGTAGTCCAGG + Intronic
1029551283 7:101238340-101238362 CACTGACAGAGCAGAAGCTCAGG - Exonic
1030378122 7:108777547-108777569 CACTGGCAGAGATGAATTTCTGG - Intergenic
1033790647 7:144789144-144789166 TACTGGCAGAACTGGAACTCAGG - Intronic
1036066794 8:5389773-5389795 CACTGGCAGAAAGGAGGTTAAGG + Intergenic
1037584069 8:20264572-20264594 CACTGGCAGAAATGAGGCCCAGG + Intronic
1038179230 8:25210920-25210942 GACTGGCAGAGCTGAGGTTGGGG + Intronic
1038762255 8:30395152-30395174 CAGTGGGAGAATTGAAGATCAGG + Intronic
1039018999 8:33184830-33184852 CAATGGCAGAACCCAAGTTTGGG + Intergenic
1039235893 8:35502433-35502455 AATTGGCAGGACTGAAGTCCAGG - Intronic
1039476073 8:37840045-37840067 CACCAGCAGGACTGAAGCTCTGG + Intronic
1042384974 8:68163884-68163906 CACTGGCAGAACTGCAGTTTTGG - Intronic
1044911102 8:97059697-97059719 CACTGGCAGAACTGCAAAACAGG + Intronic
1046107840 8:109688306-109688328 TACTAGAAAAACTGAAGTTCTGG + Intronic
1047539393 8:125749702-125749724 AAGTGGCAGAAATAAAGTTCTGG - Intergenic
1047756256 8:127921054-127921076 CAGTGGCAGAACTGAGGAACAGG + Intergenic
1048329157 8:133460573-133460595 TGCTGGCTGTACTGAAGTTCAGG + Intronic
1051371010 9:16359020-16359042 CAGTGGCAAAGCTGGAGTTCAGG - Intergenic
1051950177 9:22621579-22621601 CACTGGTAGCACTACAGTTCTGG - Intergenic
1053005612 9:34602397-34602419 CACTGGCAGGACTGACGCTGAGG - Intergenic
1053940091 9:43239309-43239331 CACTGGCCGAGGTGAAGTCCGGG - Intergenic
1055287565 9:74745720-74745742 CACTGACAGAAATGAGGTTGAGG + Intronic
1055627656 9:78190986-78191008 CACAGGCAGGACTGAAGTATGGG + Intergenic
1055655108 9:78443337-78443359 CAGAGGCAGATTTGAAGTTCAGG - Intergenic
1057309650 9:93933972-93933994 CACTGTCAAACCTGGAGTTCAGG - Intergenic
1057512714 9:95693918-95693940 AAGTGGCAGAAGTGATGTTCTGG - Intergenic
1059041056 9:110815941-110815963 CAGTGGCAGAGCTGAAATTCTGG - Intergenic
1061165986 9:128922407-128922429 CACTGGGACTACTGAAGGTCCGG - Intronic
1061196275 9:129108789-129108811 CCATGGCAGGACTGAGGTTCTGG + Intronic
1061570662 9:131475805-131475827 CACTGGCAGAGCAAAAGTCCAGG + Exonic
1187314092 X:18176021-18176043 GACTGGCAGGACTGTATTTCTGG - Exonic
1189014837 X:37086399-37086421 CAGTGGGAGAATTGAAGATCAGG + Intergenic
1190917477 X:54821331-54821353 AACTGGGAGAACTGAAGCCCAGG + Intergenic
1191958099 X:66668241-66668263 CATTGGAAAGACTGAAGTTCTGG - Intergenic
1192099663 X:68251005-68251027 AATAGGAAGAACTGAAGTTCAGG - Intronic
1193916834 X:87375770-87375792 CACTGGCAGATCTCTATTTCAGG + Intergenic
1195613610 X:106895454-106895476 AAGTGGCAGAACTAGAGTTCAGG - Intronic
1195697918 X:107680257-107680279 CACTGGTAGAGCTTTAGTTCAGG + Intergenic
1196260014 X:113567724-113567746 CACTTGCAGAACATAGGTTCAGG + Intergenic
1196299496 X:114038190-114038212 AGCTGGCAGAAGTGAAATTCTGG - Intergenic
1199074793 X:143514875-143514897 CAATGGGAGAAGTGAAGTCCAGG - Intronic
1199093797 X:143718151-143718173 CAATGGGAGAAGTGAAGTCCAGG - Intronic
1199214538 X:145250015-145250037 CAATGGGAGAAGTGAAGTCCAGG + Intronic