ID: 1021401399

View in Genome Browser
Species Human (GRCh38)
Location 7:20213531-20213553
Sequence TTTATCCAGTCCATCATTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34835
Summary {0: 2, 1: 25, 2: 687, 3: 18256, 4: 15865}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021401399_1021401402 3 Left 1021401399 7:20213531-20213553 CCCATAATGATGGACTGGATAAA 0: 2
1: 25
2: 687
3: 18256
4: 15865
Right 1021401402 7:20213557-20213579 AATGTGGTACATATACACCATGG 0: 3058
1: 26518
2: 15879
3: 9004
4: 6202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021401399 Original CRISPR TTTATCCAGTCCATCATTAT GGG (reversed) Intronic
Too many off-targets to display for this crispr