ID: 1021401402

View in Genome Browser
Species Human (GRCh38)
Location 7:20213557-20213579
Sequence AATGTGGTACATATACACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60661
Summary {0: 3058, 1: 26518, 2: 15879, 3: 9004, 4: 6202}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021401400_1021401402 2 Left 1021401400 7:20213532-20213554 CCATAATGATGGACTGGATAAAG 0: 2
1: 10
2: 81
3: 198
4: 294
Right 1021401402 7:20213557-20213579 AATGTGGTACATATACACCATGG 0: 3058
1: 26518
2: 15879
3: 9004
4: 6202
1021401399_1021401402 3 Left 1021401399 7:20213531-20213553 CCCATAATGATGGACTGGATAAA 0: 2
1: 25
2: 687
3: 18256
4: 15865
Right 1021401402 7:20213557-20213579 AATGTGGTACATATACACCATGG 0: 3058
1: 26518
2: 15879
3: 9004
4: 6202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021401402 Original CRISPR AATGTGGTACATATACACCA TGG Intronic
Too many off-targets to display for this crispr