ID: 1021402725

View in Genome Browser
Species Human (GRCh38)
Location 7:20228133-20228155
Sequence TTAGATAATACCTGTTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021402725_1021402727 20 Left 1021402725 7:20228133-20228155 CCTACAAAACAGGTATTATCTAA No data
Right 1021402727 7:20228176-20228198 CCTATTCCACTCAATTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021402725 Original CRISPR TTAGATAATACCTGTTTTGT AGG (reversed) Intergenic
No off target data available for this crispr