ID: 1021404288

View in Genome Browser
Species Human (GRCh38)
Location 7:20246326-20246348
Sequence CTAGTTCGACCGATCACATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021404288_1021404291 -4 Left 1021404288 7:20246326-20246348 CCAGATGTGATCGGTCGAACTAG No data
Right 1021404291 7:20246345-20246367 CTAGGTGAGGAAGAACATTCAGG No data
1021404288_1021404293 14 Left 1021404288 7:20246326-20246348 CCAGATGTGATCGGTCGAACTAG No data
Right 1021404293 7:20246363-20246385 TCAGGCAGCCAGGAGCGATGTGG No data
1021404288_1021404292 4 Left 1021404288 7:20246326-20246348 CCAGATGTGATCGGTCGAACTAG No data
Right 1021404292 7:20246353-20246375 GGAAGAACATTCAGGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021404288 Original CRISPR CTAGTTCGACCGATCACATC TGG (reversed) Intergenic
No off target data available for this crispr