ID: 1021404819

View in Genome Browser
Species Human (GRCh38)
Location 7:20252836-20252858
Sequence CATTGCCAAGGCCAACATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021404819_1021404821 -10 Left 1021404819 7:20252836-20252858 CCTTAATGTTGGCCTTGGCAATG No data
Right 1021404821 7:20252849-20252871 CTTGGCAATGATTTTTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021404819 Original CRISPR CATTGCCAAGGCCAACATTA AGG (reversed) Intergenic
No off target data available for this crispr