ID: 1021408184

View in Genome Browser
Species Human (GRCh38)
Location 7:20298506-20298528
Sequence ACAAAGAGACAAAATTACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021408184_1021408186 11 Left 1021408184 7:20298506-20298528 CCTGAGTAATTTTGTCTCTTTGT No data
Right 1021408186 7:20298540-20298562 AACAATGGTGTAGAAGAGACAGG No data
1021408184_1021408188 13 Left 1021408184 7:20298506-20298528 CCTGAGTAATTTTGTCTCTTTGT No data
Right 1021408188 7:20298542-20298564 CAATGGTGTAGAAGAGACAGGGG No data
1021408184_1021408185 -4 Left 1021408184 7:20298506-20298528 CCTGAGTAATTTTGTCTCTTTGT No data
Right 1021408185 7:20298525-20298547 TTGTTTATGATTTTGAACAATGG No data
1021408184_1021408189 30 Left 1021408184 7:20298506-20298528 CCTGAGTAATTTTGTCTCTTTGT No data
Right 1021408189 7:20298559-20298581 CAGGGGATTCTTCTTTCCCCTGG No data
1021408184_1021408187 12 Left 1021408184 7:20298506-20298528 CCTGAGTAATTTTGTCTCTTTGT No data
Right 1021408187 7:20298541-20298563 ACAATGGTGTAGAAGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021408184 Original CRISPR ACAAAGAGACAAAATTACTC AGG (reversed) Intergenic