ID: 1021408185 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:20298525-20298547 |
Sequence | TTGTTTATGATTTTGAACAA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1021408184_1021408185 | -4 | Left | 1021408184 | 7:20298506-20298528 | CCTGAGTAATTTTGTCTCTTTGT | No data | ||
Right | 1021408185 | 7:20298525-20298547 | TTGTTTATGATTTTGAACAATGG | No data | ||||
1021408183_1021408185 | 1 | Left | 1021408183 | 7:20298501-20298523 | CCTAACCTGAGTAATTTTGTCTC | No data | ||
Right | 1021408185 | 7:20298525-20298547 | TTGTTTATGATTTTGAACAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1021408185 | Original CRISPR | TTGTTTATGATTTTGAACAA TGG | Intergenic | ||