ID: 1021408186

View in Genome Browser
Species Human (GRCh38)
Location 7:20298540-20298562
Sequence AACAATGGTGTAGAAGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021408184_1021408186 11 Left 1021408184 7:20298506-20298528 CCTGAGTAATTTTGTCTCTTTGT No data
Right 1021408186 7:20298540-20298562 AACAATGGTGTAGAAGAGACAGG No data
1021408183_1021408186 16 Left 1021408183 7:20298501-20298523 CCTAACCTGAGTAATTTTGTCTC No data
Right 1021408186 7:20298540-20298562 AACAATGGTGTAGAAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021408186 Original CRISPR AACAATGGTGTAGAAGAGAC AGG Intergenic