ID: 1021408189

View in Genome Browser
Species Human (GRCh38)
Location 7:20298559-20298581
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021408184_1021408189 30 Left 1021408184 7:20298506-20298528 CCTGAGTAATTTTGTCTCTTTGT No data
Right 1021408189 7:20298559-20298581 CAGGGGATTCTTCTTTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021408189 Original CRISPR CAGGGGATTCTTCTTTCCCC TGG Intergenic