ID: 1021413548

View in Genome Browser
Species Human (GRCh38)
Location 7:20355373-20355395
Sequence TACTCTAGGGTCTTTCTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 128}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021413540_1021413548 17 Left 1021413540 7:20355333-20355355 CCTCACTGCCTGTCCCAGTAAAT 0: 1
1: 0
2: 0
3: 20
4: 306
Right 1021413548 7:20355373-20355395 TACTCTAGGGTCTTTCTCAGGGG 0: 1
1: 0
2: 2
3: 9
4: 128
1021413541_1021413548 9 Left 1021413541 7:20355341-20355363 CCTGTCCCAGTAAATCACTTGCT 0: 1
1: 0
2: 0
3: 33
4: 135
Right 1021413548 7:20355373-20355395 TACTCTAGGGTCTTTCTCAGGGG 0: 1
1: 0
2: 2
3: 9
4: 128
1021413543_1021413548 3 Left 1021413543 7:20355347-20355369 CCAGTAAATCACTTGCTAACAAT 0: 1
1: 0
2: 1
3: 8
4: 125
Right 1021413548 7:20355373-20355395 TACTCTAGGGTCTTTCTCAGGGG 0: 1
1: 0
2: 2
3: 9
4: 128
1021413542_1021413548 4 Left 1021413542 7:20355346-20355368 CCCAGTAAATCACTTGCTAACAA 0: 1
1: 0
2: 0
3: 14
4: 183
Right 1021413548 7:20355373-20355395 TACTCTAGGGTCTTTCTCAGGGG 0: 1
1: 0
2: 2
3: 9
4: 128
1021413539_1021413548 22 Left 1021413539 7:20355328-20355350 CCATGCCTCACTGCCTGTCCCAG 0: 1
1: 1
2: 5
3: 61
4: 614
Right 1021413548 7:20355373-20355395 TACTCTAGGGTCTTTCTCAGGGG 0: 1
1: 0
2: 2
3: 9
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021413548 Original CRISPR TACTCTAGGGTCTTTCTCAG GGG Intronic
904039044 1:27573931-27573953 TACACCAGGGTCTTTCCCAGTGG + Intronic
904210424 1:28883578-28883600 TGCTTTAGGGTCTTCCTCATAGG + Intergenic
907084074 1:51653038-51653060 TAATTTGGTGTCTTTCTCAGCGG - Intronic
920998128 1:211014808-211014830 TGCTCTAGGTTCTTTCTCTGGGG - Intronic
921892578 1:220367950-220367972 TTCTCAAGGGTATTTCACAGAGG + Intergenic
922889837 1:229053239-229053261 CCCTTGAGGGTCTTTCTCAGAGG - Intergenic
924680334 1:246224599-246224621 TCCTCTATATTCTTTCTCAGTGG - Intronic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1065036606 10:21645641-21645663 TACTCTAGAGTTTTCCTGAGAGG + Intronic
1068411056 10:56655430-56655452 TATTTTAGGGTCTTTCTTTGTGG - Intergenic
1070166716 10:73904429-73904451 TACTCTAGGGTTCTTCTATGGGG - Intergenic
1071231945 10:83598183-83598205 AATTCTAAGGTCTTGCTCAGGGG + Intergenic
1071842919 10:89491486-89491508 TCCTCTAGGGTCTGGCTCAGTGG - Intronic
1073858257 10:107703965-107703987 TACTCTTGAGTTTTCCTCAGTGG - Intergenic
1078354247 11:10622536-10622558 TACTCTAGGGTCTCGCTCTGGGG - Intronic
1078363657 11:10689583-10689605 TTCTTTGGGGACTTTCTCAGTGG - Intronic
1080102342 11:28473989-28474011 TACTCTAGAGTCTTTCACAGAGG - Intergenic
1081198305 11:40187571-40187593 ATCTTCAGGGTCTTTCTCAGTGG - Intronic
1082623597 11:55455876-55455898 TCCTCTAGGGATTTTCTAAGGGG + Intergenic
1083885521 11:65571741-65571763 TTCTAGAGGGTTTTTCTCAGGGG - Exonic
1088829717 11:113524768-113524790 CATTCTTGGGTGTTTCTCAGAGG - Intergenic
1091693411 12:2612019-2612041 GAATCAAAGGTCTTTCTCAGAGG - Intronic
1093920794 12:24857034-24857056 TGCTCTAGGCTCCTTCTCGGAGG + Intronic
1097119395 12:56719853-56719875 TACAGTAGGGTCTTTCTTGGTGG + Exonic
1097866011 12:64559709-64559731 TCCTCTGGGGTCCTTATCAGGGG + Intergenic
1102459284 12:113090327-113090349 TCCTCCAGGGCCTTCCTCAGGGG - Intronic
1109133404 13:58616824-58616846 TTCTCTAGCTTCTTTCTTAGGGG - Intergenic
1111827391 13:93284865-93284887 TAATGTAGAGTCTTTATCAGAGG + Intronic
1112381506 13:98895186-98895208 TAATCTATGGTCTATCTCAATGG + Intronic
1113504453 13:110805487-110805509 TACTCTAGGGAATGGCTCAGAGG - Intergenic
1114698422 14:24649933-24649955 TACTATATGGTCTATCTTAGAGG - Intergenic
1116507444 14:45702319-45702341 TACTCTATGATATTTTTCAGTGG + Intergenic
1119015305 14:71045241-71045263 TACTCTAGTGTCTTTAGCAGAGG - Exonic
1123790059 15:23711110-23711132 TAAGCTATGGTCCTTCTCAGTGG - Intergenic
1125104869 15:35958825-35958847 AACGCTGGGGTCTTGCTCAGGGG - Intergenic
1127287909 15:57546744-57546766 TGCTCTAGGGTCTCTCCCCGGGG + Intronic
1127869873 15:63062772-63062794 TCCTCTGGGGTTTTTCTCTGTGG + Intronic
1128411626 15:67404879-67404901 TACTCCTGGGTCTTTCTCCTCGG - Intronic
1129960108 15:79676396-79676418 TACTCTGGGGGCTTACTAAGGGG - Intergenic
1136519625 16:30787124-30787146 GACTCTGGGGTCCTTCTCAAGGG + Exonic
1203146199 16_KI270728v1_random:1803430-1803452 TAGTCTAGAGTCCTTCTCAATGG - Intergenic
1144595454 17:16566570-16566592 TCCTCTGGGGTCTTCCTCTGGGG + Exonic
1148025566 17:44585272-44585294 TCCTTCAGGGTCTTTCTCAAAGG + Intergenic
1148322681 17:46767055-46767077 CACACTAGGCTCCTTCTCAGGGG + Intronic
1149772625 17:59332782-59332804 TTCTCTGGGGCCTTTCACAGCGG - Intronic
1150098779 17:62403326-62403348 TACACTAGGGTGTTTCTGTGGGG - Intronic
1153046844 18:863843-863865 TACTTTCTGGTCTTTCTCTGTGG + Intergenic
1156845540 18:41661699-41661721 TTCTCTAGGGTGTATCACAGGGG + Intergenic
1160471710 18:79140819-79140841 TACATTTGGATCTTTCTCAGAGG + Intronic
1166266285 19:41686557-41686579 TTCTCCAGGGTCTTTTTCAGGGG + Intronic
1166909384 19:46140961-46140983 TACTCTGGTGTGTTTCACAGCGG - Intergenic
1166923937 19:46252608-46252630 TACTCTGGTGTGTTTCACAGCGG + Intergenic
925555146 2:5122533-5122555 GACTCCAGGGTCTTCATCAGTGG - Intergenic
929176019 2:38977030-38977052 TACTCTAGGGTTCTCCCCAGTGG + Intergenic
929991982 2:46797935-46797957 CACTCAAGGGTCTGTCTCTGAGG + Intergenic
932360234 2:71099053-71099075 TACTCCAGCGTCTCTCTCATTGG + Intergenic
940147351 2:150560249-150560271 TCCTTTAGGGTCTTCCTCATAGG + Intergenic
1169567595 20:6872487-6872509 TTTTCTAGGGTCATTCTCATTGG + Intergenic
1171492599 20:25531949-25531971 GACTCAAAGTTCTTTCTCAGGGG + Intronic
1172026966 20:31955185-31955207 TCCTCTTGGGTCTCTCACAGAGG - Intergenic
1173106345 20:40139692-40139714 TACTCTAGGGTTTTTTTTAGTGG + Intergenic
1173846987 20:46194404-46194426 TCCTCTATGGTCCTTCTGAGAGG + Intronic
1179420449 21:41231951-41231973 TTCTCTGGGGTTTTACTCAGAGG + Intronic
1182625397 22:31642159-31642181 CACTCTTGGCTCTTCCTCAGTGG - Intronic
1182695797 22:32198685-32198707 TCCTCCAGGGTCTTTCTCCCTGG - Intronic
1184284749 22:43464211-43464233 CACTGTGGGGTTTTTCTCAGAGG + Intronic
1185273109 22:49937610-49937632 TACTCTAGGGTCTTGCTCTGGGG + Intergenic
953117552 3:40008101-40008123 TACCCCAGGGTCTTCCCCAGAGG - Intronic
955917890 3:63924928-63924950 TACTCTTGGATCATTCCCAGTGG - Intronic
957294143 3:78314513-78314535 AATTACAGGGTCTTTCTCAGAGG + Intergenic
958680741 3:97328663-97328685 TACTATATGGCCTTTCACAGAGG + Intronic
958939110 3:100290361-100290383 CACTCTAGGGACATTCTCACAGG - Intronic
960475391 3:118118265-118118287 TAATCTTGTGGCTTTCTCAGTGG + Intergenic
961709439 3:128816253-128816275 CATTCTTGGGTGTTTCTCAGAGG + Intergenic
961900455 3:130205542-130205564 TACTCTAGGGCTTTTCTCTTTGG - Intergenic
965137070 3:164785262-164785284 CATTCTTGGGTGTTTCTCAGAGG - Intergenic
965839115 3:172882872-172882894 TACTCTACTTTCTATCTCAGAGG + Intergenic
966248322 3:177833665-177833687 TATTCCAGGGTTTTTCTGAGGGG - Intergenic
967614872 3:191552742-191552764 TTTTCAAGTGTCTTTCTCAGTGG - Intergenic
968262200 3:197334591-197334613 TTCTCTAGGGTCTGCTTCAGGGG - Intergenic
970184876 4:13440907-13440929 CATTCTAAGGCCTTTCTCAGTGG - Intronic
971739270 4:30499819-30499841 TACTCTTGGGTGCTTCTCATTGG - Intergenic
977285639 4:95102834-95102856 TAATCTAGGGTTTTTCTAAGTGG + Intronic
979619076 4:122777959-122777981 TACTCCAGTGTCTTACTCAAAGG + Intergenic
979791033 4:124781276-124781298 TCCTCTAGGGCCTTTCTCCTTGG + Intergenic
979963511 4:127049923-127049945 TTGTCTAGAGTCTATCTCAGGGG - Intergenic
980101520 4:128545998-128546020 TTCTCTAGGGTATGTATCAGTGG + Intergenic
980193850 4:129561945-129561967 TACTCTAGGAACTTTGTAAGTGG + Intergenic
983028239 4:162764591-162764613 TACTCTGGGGCCTTTCAAAGAGG + Intergenic
988094265 5:26583231-26583253 TACTACAGGGTCTGTTTCAGAGG - Intergenic
988915207 5:35885509-35885531 TAAGCTAGGGTCATGCTCAGTGG + Intergenic
989490134 5:42041049-42041071 CCCTCTTGTGTCTTTCTCAGAGG + Intergenic
989554233 5:42773443-42773465 TACACAAGGTTCTTTCTCTGAGG + Intronic
990467308 5:56082438-56082460 AACTATAGTCTCTTTCTCAGTGG + Intergenic
990757573 5:59091697-59091719 AATTATAGGGTCTTTCTGAGGGG + Intronic
992855556 5:80857437-80857459 TTCTCTATAGTCTTTTTCAGAGG - Intronic
993567105 5:89489570-89489592 TACCCTAGGGTCTTTCCCTAGGG - Intergenic
997884027 5:137614893-137614915 GACACTGGGGTCTTTCCCAGAGG + Intergenic
999228508 5:150047376-150047398 TATTTTAGGGTTTTTTTCAGTGG + Intronic
1000155897 5:158551523-158551545 TACTCTTGAGTCTTTATCTGAGG + Intergenic
1002458455 5:179359804-179359826 TTTTCCAGGGTCCTTCTCAGAGG - Intergenic
1003720576 6:8697387-8697409 AAATATAGGGTCTTTCTAAGAGG + Intergenic
1003907701 6:10717842-10717864 TTATCTACGGTCTTTGTCAGTGG - Intergenic
1003997358 6:11556373-11556395 TACTGCAGGGTTATTCTCAGTGG + Intronic
1004449613 6:15732976-15732998 TACTTTAGTGTCTTTCTCTCTGG - Intergenic
1007365569 6:41389490-41389512 TATTCTTGGGTATTTCTCATTGG - Intergenic
1007455721 6:41975563-41975585 TACTGTAGGATCTTCCCCAGGGG + Intronic
1014464078 6:121733632-121733654 TACTCTTGGCTCTTTGTGAGTGG + Intergenic
1015441966 6:133258902-133258924 AACCCTAGGGTCTTTCTCAAAGG + Intronic
1016292320 6:142538954-142538976 TCCAGTGGGGTCTTTCTCAGAGG - Intergenic
1018247471 6:161836642-161836664 TACTCTTAGGTTTTTCTCCGTGG - Intronic
1018267810 6:162043887-162043909 TTCTCCAGGGTGTTCCTCAGTGG - Intronic
1021413548 7:20355373-20355395 TACTCTAGGGTCTTTCTCAGGGG + Intronic
1022193640 7:28042293-28042315 AACTCTAAGGTCTTTCTGAATGG - Intronic
1025623255 7:63193717-63193739 TCCTCTAGGGCCATTTTCAGTGG + Intergenic
1026783070 7:73283316-73283338 AATTCTTGGGTGTTTCTCAGAGG + Intergenic
1026983750 7:74541584-74541606 TAAGATAGGGTCTTACTCAGTGG - Intronic
1028273859 7:88826559-88826581 TATGCTAAGGTCTTTCTCATGGG + Intronic
1032525083 7:132573909-132573931 TTCTCTGAGGTCTTTCTCACTGG - Intronic
1033441631 7:141385355-141385377 TGCTCTAGGGGCATTCTCACGGG + Intronic
1035195348 7:157214946-157214968 GACTCTATGGTGTTGCTCAGGGG - Intronic
1038261007 8:25993969-25993991 TACCTTAGAGTCTTTCTCTGAGG - Intronic
1038749746 8:30284434-30284456 TGCTCTAGGATCTTCTTCAGAGG + Intergenic
1040870777 8:52098456-52098478 TACTCTGAGGTCTCTCTCCGTGG - Intergenic
1042227823 8:66528264-66528286 TAATCAAGGGTCTTTATAAGAGG - Intergenic
1045748996 8:105459418-105459440 TACCCTAGGGGCTCTCTCTGTGG + Intronic
1050944056 9:11495608-11495630 TCCTCTAGGGGCATTCTCACTGG - Intergenic
1051519451 9:17968963-17968985 TCGTCTAGGGTCTTTCTTTGAGG + Intergenic
1052151899 9:25127407-25127429 TACACTGGGGTCTTTCAGAGTGG + Intergenic
1052534715 9:29732239-29732261 TACTCTAGCGGCTTCCCCAGGGG + Intergenic
1052593147 9:30524574-30524596 TACTCTGGGCTATTTGTCAGTGG + Intergenic
1052649950 9:31290253-31290275 TATTCCATGGTCTCTCTCAGTGG - Intergenic
1052739714 9:32381873-32381895 TACTCTAGGGACCTTCAGAGAGG - Intergenic
1053199449 9:36142729-36142751 TATTCTTGGGTTTTTCTCGGTGG + Intronic
1053396760 9:37782189-37782211 TACTATTGGTTCTTTCTCACAGG + Intronic
1056228931 9:84525787-84525809 CATTCTTGGGTGTTTCTCAGAGG + Intergenic
1058859483 9:109100934-109100956 AACCCAAGGGTCTTACTCAGTGG - Intronic
1059339920 9:113591905-113591927 TACTATAGGGTGTTTGTTAGAGG + Intronic
1192225762 X:69226804-69226826 TCCTCCAGGGTCTCCCTCAGTGG + Intergenic
1197772783 X:130100038-130100060 AACTATAGAGTGTTTCTCAGTGG + Intronic