ID: 1021414464

View in Genome Browser
Species Human (GRCh38)
Location 7:20366155-20366177
Sequence ATGTTCCTTTCTAACATCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021414460_1021414464 -7 Left 1021414460 7:20366139-20366161 CCTAGTTTAATGCCCCATGTTCC 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1021414464 7:20366155-20366177 ATGTTCCTTTCTAACATCTATGG 0: 1
1: 0
2: 1
3: 14
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021414464 Original CRISPR ATGTTCCTTTCTAACATCTA TGG Intronic
904506266 1:30957048-30957070 ATGTACTTGTCTGACATCTAAGG - Intronic
907143599 1:52211806-52211828 ATTTTCTTTTTTAAAATCTATGG + Intronic
907921002 1:58911604-58911626 ATTTTCCTTTTACACATCTATGG + Intergenic
908505613 1:64795761-64795783 TTCTTCCTTTCCAACATGTATGG + Intronic
908664102 1:66470631-66470653 TTTATCCTTTCTAACATCTTTGG - Intergenic
908729709 1:67213339-67213361 ATGTTACTCTCTAGCCTCTAGGG + Intronic
909581599 1:77241755-77241777 ATGTTCCTTACTCACCTGTAAGG + Intergenic
909802961 1:79836278-79836300 ATGTCTCTTTATAACATTTAGGG + Intergenic
910324809 1:85994555-85994577 ATTTTGTTTTCTAACATTTATGG + Intronic
917756783 1:178109406-178109428 ATGTTCTTTTCTAAAAGCTCAGG + Intronic
918039576 1:180905193-180905215 ATTATCCTTTCTACCATCAATGG + Intergenic
921611029 1:217212760-217212782 ATTTTACTTTTTAACATCAAAGG - Intergenic
923819586 1:237423300-237423322 TTTCTCCTTTCTAACATCAAAGG - Intronic
1064396809 10:14989107-14989129 ATATTGTTTTCTAACATCCAGGG + Intergenic
1064399721 10:15011573-15011595 ATATTGTTTTCTAACATCCAGGG + Intergenic
1068636943 10:59358596-59358618 TTGTTGCTTTCAAAGATCTAGGG + Intronic
1071324109 10:84494663-84494685 ATATTCCTTCCTAACTTGTAGGG + Intronic
1074384471 10:113005964-113005986 ATGTTCTTTTCTTACCTCTGTGG - Intronic
1074594140 10:114844705-114844727 ATGTTACTTGGTAACATTTAGGG + Intronic
1074749581 10:116571937-116571959 ATGATGCTATGTAACATCTAAGG - Intergenic
1074962366 10:118458746-118458768 ATGTTGCTTGGTGACATCTAGGG + Intergenic
1077604816 11:3602276-3602298 ATATTGTTTTCTAACATCCAGGG + Intergenic
1079501340 11:21104811-21104833 ATGTTATTTTCTCACATCTCTGG + Intronic
1080744156 11:35092718-35092740 CAGTTTCTTTCTAACATCAATGG - Intergenic
1081045862 11:38272244-38272266 ATGTTTGTTTCTAAAATATAAGG - Intergenic
1084227283 11:67725089-67725111 ATATTGTTTTCTAACATCCAGGG + Intergenic
1084260714 11:67976860-67976882 ATATTGTTTTCTAACATCCAGGG + Intergenic
1084807912 11:71591759-71591781 ATATTGTTTTCTAACATCCAGGG - Intronic
1084811942 11:71617332-71617354 ATATTGTTTTCTAACATCCAGGG - Intergenic
1084845021 11:71891778-71891800 ATATTGTTTTCTAACATCCAGGG - Intronic
1086099173 11:83081333-83081355 ATATTGCTTTATAACACCTAAGG - Intergenic
1086726523 11:90191991-90192013 ATGTTCCTTGCTATAATTTAGGG - Exonic
1088320570 11:108550884-108550906 ATCTTCCAGTCTAAAATCTATGG + Intronic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1092431974 12:8417412-8417434 ATATTGTTTTCTAACATCCAGGG + Intergenic
1092434983 12:8440578-8440600 ATATTGTTTTCTAACATCCAGGG + Intergenic
1093473950 12:19534386-19534408 ATTTTTCTATATAACATCTATGG - Intronic
1095077285 12:37946283-37946305 AAGTTCCTTTCTAGCTTTTATGG + Intergenic
1097824736 12:64163388-64163410 ATGTACCTTTTTAACATTCAGGG - Intergenic
1098298495 12:69028905-69028927 AGGTTCTTTCCTAACATTTATGG + Intergenic
1101127723 12:101654679-101654701 ATGTTCCTTTCTTGAATCTTGGG - Intronic
1103767386 12:123290389-123290411 ATGTTCCTTTATAACTTTCAAGG - Exonic
1105091250 13:16292902-16292924 ATGTTTCTTTCTAGCTTGTAGGG - Intergenic
1105099557 13:16429374-16429396 ATGTTTCTTTCTAGCTTGTATGG - Intergenic
1105113021 13:16649718-16649740 ATGTTTCTTTCTAGCTTGTAGGG - Intergenic
1105114449 13:16672902-16672924 ATGTTTCTTTCTAGCTTGTAGGG - Intergenic
1105114709 13:16676994-16677016 ATGTTTCTTTCTAGCTTGTAGGG - Intergenic
1105121718 13:16791455-16791477 ATGTTTCTTTCTAGCTTGTAGGG - Intergenic
1105130142 13:16929074-16929096 ATGTTTCTTTCTAGCTTGTAGGG - Intergenic
1105132817 13:16972727-16972749 ATGCTTCTTTCTAACTTGTAGGG - Intergenic
1105137226 13:17044699-17044721 ATGCTTCTTTCTAGCATGTAGGG - Intergenic
1105141119 13:17108650-17108672 ATGTTTCTTTCTAGCTTGTAGGG - Intergenic
1105153917 13:17317275-17317297 ATGCTTCTTTCTAGCTTCTAGGG - Intergenic
1105156175 13:17354117-17354139 ATGTTTCTTTCTAGCTTGTAGGG - Intergenic
1105159361 13:17405972-17405994 ATGCTTCTTTCTAGCATGTAGGG - Intergenic
1105281876 13:18969063-18969085 ATGTTCCTTTCTACCTTCCAAGG + Intergenic
1105431031 13:20338066-20338088 CGCTGCCTTTCTAACATCTAGGG + Intergenic
1107281197 13:38737405-38737427 ATATTTCTCTCTAAAATCTATGG + Intronic
1108649487 13:52462110-52462132 AGGTTGCTTTTTAAAATCTAAGG + Intronic
1111155906 13:84325054-84325076 AGATTCCTTTGTAGCATCTAAGG + Intergenic
1111832503 13:93347083-93347105 ATGTTCTTTTTGAACATGTAGGG + Intronic
1111834978 13:93377034-93377056 ATTTTCCTTTCTAACTTAGATGG + Intronic
1114520878 14:23334918-23334940 ATGTTTATTTCAAACATCCATGG - Intergenic
1114863648 14:26559171-26559193 ATTTTCCTTTGTCACTTCTATGG + Intronic
1115160850 14:30391892-30391914 TTGTTCCTAACTATCATCTAAGG + Intergenic
1115375123 14:32665984-32666006 ATATTCTTATCTAACATTTAAGG + Intronic
1116932756 14:50705898-50705920 ATGTACCTTGCTGACATCTTGGG + Intergenic
1117039220 14:51754261-51754283 ATATTGTTTTCTAACATCGAGGG - Intergenic
1117226793 14:53669417-53669439 AAATTCCCTTCTACCATCTAGGG + Intergenic
1118991019 14:70797092-70797114 CTGAACCTTTCTAACAGCTAGGG + Intronic
1119037747 14:71245128-71245150 ATATTCATTTCTAATATCCAAGG - Intergenic
1120532140 14:85644654-85644676 ATGTTGCCTTCAAACATCCAGGG - Exonic
1121700124 14:95946554-95946576 ATTTTCCTTACTATCATCTGGGG + Intergenic
1125014368 15:34917119-34917141 ATGTTGCTTTCTCATGTCTAGGG - Intronic
1126585881 15:50286573-50286595 ATTTTCCTTTCTTACATAAAAGG + Intronic
1127252080 15:57250063-57250085 TTATACCTTTCTAACATCAAAGG + Intronic
1128985429 15:72217136-72217158 ATCTTCCTTTGTAAAAGCTAAGG + Intronic
1131021201 15:89100561-89100583 AGGTTCCTTTTTAACATCTAAGG - Intronic
1131726561 15:95232501-95232523 ATCTTCCTTTTTAATATCTAGGG - Intergenic
1134890054 16:17832982-17833004 ATGTTCCTCTTTAGCATGTATGG - Intergenic
1135585131 16:23664427-23664449 ATGTTCTTTGCTAAAATCTGAGG + Intronic
1138911744 16:61409098-61409120 ATGTACCTTTCTAAAATAAAAGG - Intergenic
1140248877 16:73276907-73276929 ATGTTCCTTTCTACCTTCCAAGG + Intergenic
1143433117 17:6901469-6901491 ATGTTCCTTTTAAAAATATATGG - Intronic
1146227350 17:31078443-31078465 ATGTTCCTGTGTCACATCTTTGG + Intergenic
1146387132 17:32387351-32387373 ATGTTACTTTTAAAAATCTAAGG + Intergenic
1148880607 17:50723345-50723367 ATGTTCTTTTCTAAAATCTTTGG + Intronic
1149125572 17:53226711-53226733 ATTTTCTTTTCTAATATTTAAGG - Intergenic
1149410214 17:56397203-56397225 GTGTTCCTGTTTAACATCTGAGG - Intronic
1153070065 18:1095491-1095513 ATGTTCATTTTAAACATCCAAGG - Intergenic
1155373091 18:25124838-25124860 ATATATCTTTCTAACACCTATGG - Intronic
1155424192 18:25689179-25689201 ATGTTGCTATAAAACATCTAGGG + Intergenic
1156028898 18:32689921-32689943 ATGTGCCTTTCTACCCTCCAAGG - Intronic
1156876946 18:42025766-42025788 ATATTCATTTTTTACATCTAAGG - Intronic
1158760227 18:60376298-60376320 ATGTTAGTTCCTGACATCTAAGG - Intergenic
1164910232 19:32005145-32005167 ATCTTCCTTACTGACATTTAGGG - Intergenic
1168574305 19:57496208-57496230 ATGTTCCTTTCTAGAGTCTCAGG + Intronic
1168679056 19:58300544-58300566 ATTTACCTTTCTAACCTCTGTGG + Exonic
925868584 2:8250108-8250130 ATGTTATTTTCTAACATTTTAGG + Intergenic
926866823 2:17369242-17369264 CTGATCCCTTCTAACTTCTAGGG + Intergenic
930584785 2:53256260-53256282 ATGTTTCTTTTTAACCCCTAAGG - Intergenic
932350369 2:71026174-71026196 ATATTGTTTTCTAACATCCAGGG - Intergenic
935548130 2:104422656-104422678 TTGTTCCTTTCTGACTTGTATGG + Intergenic
936744269 2:115555550-115555572 ATGTTCCCTTCTCCCATCTCAGG - Intronic
940872605 2:158871939-158871961 ATATTGTTTTCTAACATCCAGGG - Intergenic
941787302 2:169511850-169511872 AAATTCCTTTCAAACAACTAAGG - Intronic
943623227 2:190172650-190172672 GTGTTGCTTTCCAACATCTCAGG - Intronic
946292867 2:218758937-218758959 CTGTTCCTTTTTTATATCTAAGG - Intergenic
946770081 2:223080125-223080147 ATGTGCCTCTCTGACTTCTAAGG + Intronic
947125782 2:226866812-226866834 ATGTATTTTTCTAACCTCTATGG - Intronic
947392311 2:229651757-229651779 ATGTTCCTTTTTGAAATCCAGGG - Intronic
1168867852 20:1104578-1104600 GTGTTCCTTTCCCACTTCTAGGG - Intergenic
1169634078 20:7667282-7667304 ATGCTCCATTCTAAGTTCTAGGG - Intergenic
1169940155 20:10928249-10928271 ATGATCATTTCTAAAATATAAGG - Intergenic
1169951016 20:11043205-11043227 ATGTTCCTTTATAACAAATCTGG - Intergenic
1170828823 20:19821621-19821643 TTGCTCCTTTCTCACTTCTAGGG + Intergenic
1171067157 20:22028712-22028734 ATGTTTATTTCTCTCATCTACGG - Intergenic
1173451440 20:43167711-43167733 ATGGACCTTTCTAACATATGTGG - Intronic
1174209967 20:48870119-48870141 ATGTGCATTTCTAATATGTAAGG + Intergenic
1174439795 20:50541550-50541572 ATGTTCCTTTCTAAGAGCCTGGG + Intronic
1174673743 20:52333178-52333200 AAGTTCCTTTGTACCATATAAGG + Intergenic
1175063158 20:56262232-56262254 TTCTTTCTTTCTAACATTTAAGG + Intergenic
1175668040 20:60877114-60877136 ATCTTCCCTTCTCACATCTGAGG + Intergenic
1177174552 21:17689827-17689849 ATCTTCCTTTCCCACTTCTATGG + Intergenic
1177801947 21:25836462-25836484 ATGATCCTTTCACAAATCTATGG + Intergenic
1178683000 21:34688977-34688999 ATCTTCCTTTCTAATCTCTCAGG + Intronic
1183852008 22:40597845-40597867 ATGTTCATTTAAAACATTTATGG + Intronic
949884987 3:8685517-8685539 ATATTGTTTTCTAACATCCAGGG - Intronic
951782482 3:26379664-26379686 AGTTTCCTCTCTAACATCTTAGG - Intergenic
953348939 3:42200058-42200080 ATGTTCCTTACAAACACCTTGGG - Intronic
953594417 3:44295920-44295942 ATATTCTTTTCAAGCATCTATGG + Intronic
953709318 3:45256863-45256885 ATGTTTCTTTCAAAAATTTAAGG - Intergenic
955035703 3:55265159-55265181 CTTTTCCTTTCTATCATCTCTGG + Intergenic
955123193 3:56082654-56082676 ATATTCCTTTCCCACATCAAGGG - Intronic
957043980 3:75360154-75360176 ATATTGTTTTCTAACATCCAGGG + Intergenic
957275319 3:78083549-78083571 ATGTTCCTTTCTTTCCTCTGAGG - Intergenic
959374361 3:105570044-105570066 ATGTTATTTTCTATCAGCTATGG - Intronic
960291887 3:115895840-115895862 ATTTTACATTCTAACTTCTAGGG + Intronic
961272655 3:125700609-125700631 ATATTGTTTTCTAACATCCAGGG - Intergenic
965357205 3:167691076-167691098 ATTTTACTTTCTTATATCTAAGG - Intronic
968295655 3:197574749-197574771 ATTTTCCTTTCACACACCTAAGG + Intergenic
968988329 4:3891934-3891956 ATATTGTTTTCTAACATCCAGGG + Intergenic
969019320 4:4129234-4129256 ATATTGTTTTCTAACATCCAGGG + Intergenic
969023955 4:4159111-4159133 ATATTGTTTTCTAACATCCAGGG + Intergenic
969553220 4:7886522-7886544 ATGTTCCTTTCTGAATTCTAAGG + Intronic
969734635 4:8978785-8978807 ATATTGTTTTCTAACATCCAGGG - Intergenic
969786030 4:9457585-9457607 ATATTGTTTTCTAACATCCAAGG - Intergenic
969789475 4:9482072-9482094 ATATTGTTTTCTAACATCTAGGG - Intergenic
969793947 4:9511240-9511262 ATATTGTTTTCTAACATCCAAGG - Intergenic
969998399 4:11338885-11338907 ATGTCTCTTTCTAAAATGTAAGG + Intergenic
970219918 4:13799584-13799606 ATGTCCCTGTCTAACAGCTTTGG + Intergenic
970255088 4:14159570-14159592 TTCTTCCTTTCTAACATAAAGGG + Intergenic
971820866 4:31553120-31553142 ATATTCTTTTCTAATATCCATGG - Intergenic
975774069 4:77764785-77764807 ATATTCCTTTCTAACTTTTAGGG - Intronic
976221480 4:82759965-82759987 CTGTTCCTTCCCAGCATCTATGG + Intronic
978685409 4:111436614-111436636 ATGTTTCTTTCTACCATGAATGG - Intergenic
979585767 4:122414958-122414980 GAGTTACTTTCAAACATCTAAGG - Intronic
980525097 4:133979729-133979751 ATGTGACTGTCTAAAATCTATGG + Intergenic
980748449 4:137054749-137054771 ATGCTCTTTTCTAAGAGCTAAGG - Intergenic
980882044 4:138720945-138720967 TTGTTCCTTGCTAACAACTCTGG - Intergenic
981094939 4:140769472-140769494 CAGTTCCTTTCTAAAATCTGTGG + Intergenic
982591368 4:157316355-157316377 AACTTCCTTTCAAACAGCTATGG + Intronic
983289040 4:165777900-165777922 ATGTTCCTTTCTAGAACTTAAGG - Intergenic
984191602 4:176612805-176612827 ATTTTCCCTTCTAACCTCTTTGG + Intergenic
985333224 4:188864128-188864150 ATTTTGCTTTCTAACATATTTGG - Intergenic
987532311 5:19137624-19137646 AGCTTACTTACTAACATCTAAGG - Intergenic
990687225 5:58318645-58318667 ATGTTCCTTTTTAGCATGTGGGG + Intergenic
991029874 5:62071665-62071687 GTGTTCCTTTGTAGCATCCAAGG - Intergenic
991980510 5:72225563-72225585 ATGTTTCTTTCAAAGTTCTAAGG - Intronic
994001528 5:94787207-94787229 ATGTTTCTTTTAAATATCTATGG + Intronic
994078722 5:95682661-95682683 ATGTTCTTTTGAAACATTTAGGG - Intronic
994259368 5:97638694-97638716 ATTTTTCTTTCTAAAATCTAAGG + Intergenic
994809923 5:104502812-104502834 ATGTTTCTTTCTCACATGGAAGG + Intergenic
994982197 5:106889819-106889841 ATTTTGCTTTCTAATATTTATGG - Intergenic
1000621463 5:163491278-163491300 ATGTTCCTTTCACATATTTAAGG - Exonic
1000987885 5:167880806-167880828 ATGGTCCTTTATAAGAACTAAGG - Intronic
1001123819 5:169001492-169001514 ATGTTCCATTGTAACACTTAAGG - Intronic
1001386109 5:171340453-171340475 ATTTTACTTTGTAACATATAGGG + Intergenic
1004049678 6:12063984-12064006 ATGTTCCTTGCCAAAATCTGAGG - Intronic
1004098981 6:12588881-12588903 TTTTTCCTTTCTAATATCTATGG - Intergenic
1004646836 6:17570348-17570370 ATTTTCCTTTCACAGATCTATGG + Intergenic
1005119585 6:22375171-22375193 ATGTTACTTTCTAACAGGTCTGG + Intergenic
1005181253 6:23109452-23109474 ATGTCCCTTTCTAACAGGTCTGG - Intergenic
1005395790 6:25380670-25380692 TTCTTCCTTTTTAAAATCTAAGG + Intronic
1010708591 6:79144314-79144336 ATGTTCATTTATAACACCTCAGG + Intergenic
1013424066 6:109994728-109994750 ATGTCCCTTCCTTACATCTTAGG + Intergenic
1013791892 6:113846776-113846798 ATTTTCCTTTCAAACATCTCTGG - Intergenic
1014239974 6:119006202-119006224 ATGTTCCTTCCTAAACTCTAAGG - Intronic
1014542745 6:122696876-122696898 ATGTTCCTTTCTCTCATGAAAGG - Intronic
1014770828 6:125456303-125456325 AAGTTCTTTTCTAACACCTATGG - Intergenic
1014974827 6:127867067-127867089 CTGTTCCTTTCTTTCTTCTAGGG + Intronic
1015449215 6:133344983-133345005 CTGTTCCTTTCTAAAATGGAAGG - Intronic
1018357298 6:163031020-163031042 ATATTCCTGCCTAACTTCTAGGG + Intronic
1018581846 6:165314773-165314795 ATGTACTTTTATAACATCTTAGG - Intergenic
1019286803 7:227469-227491 ATGTTTTTTTTAAACATCTAGGG + Intronic
1020306602 7:6840653-6840675 ATATTGTTTTCTAACATCCAGGG + Intergenic
1020311060 7:6869279-6869301 ATATTGTTTTCTAACATCCAGGG + Intergenic
1021414464 7:20366155-20366177 ATGTTCCTTTCTAACATCTATGG + Intronic
1022178190 7:27892840-27892862 ATGTTCATTTCTTTCATCTGGGG - Intronic
1022490605 7:30814919-30814941 ATTTTCCTTTCAAACTTATAAGG - Intronic
1022871595 7:34486055-34486077 ATGTTCCTTCTTGACATCTGGGG - Intergenic
1023044668 7:36200455-36200477 CTGTTCTTTTCTAAGATTTATGG + Intronic
1023340567 7:39214922-39214944 ATGTTCATCTCTAACATTTCAGG - Intronic
1026209610 7:68292319-68292341 ACTTTCCTTTCTTACTTCTAAGG - Intergenic
1027813538 7:82938315-82938337 ATGTGCCTTTCTAACAAACATGG - Intronic
1029077759 7:97949597-97949619 ATGTTGTTTTCTAACATCCAGGG + Intergenic
1029808218 7:103018387-103018409 CAGTTTCTTTCTAACATCGATGG - Intronic
1031547932 7:123072868-123072890 ATGTTTCTTTTAAACATATAAGG + Intergenic
1032766984 7:135004162-135004184 AAATGCCTTTTTAACATCTATGG + Intronic
1036565233 8:9932791-9932813 TTCTTCCTTTCTATCATCAAGGG - Intergenic
1036695340 8:10970767-10970789 TTGCTCCTTTATAAAATCTAAGG - Intronic
1036819771 8:11931300-11931322 ATATTGTTTTCTAACATCCAGGG + Intergenic
1036832937 8:12036251-12036273 ATATTGTTTTCTAACATCCAAGG + Intergenic
1036903093 8:12686673-12686695 ATATTGTTTTCTAACATCCAGGG + Intergenic
1036974340 8:13394153-13394175 ATGTTCCTATTCAACCTCTATGG + Intronic
1037961351 8:23100736-23100758 ATAGTCCTATCTAATATCTATGG - Intronic
1038777406 8:30543395-30543417 TTATTCCTTCCTACCATCTAAGG - Intronic
1039126257 8:34205205-34205227 ATTTTCCTTTTTCACCTCTACGG + Intergenic
1041778044 8:61545925-61545947 GTGTACCTCTCTATCATCTAAGG - Intronic
1042884346 8:73531307-73531329 ATGTTCCTTTGTGATATCTTTGG - Intronic
1043590953 8:81833414-81833436 ATTTATCTTTGTAACATCTAAGG + Intronic
1043658708 8:82707325-82707347 ATGTTTCCTTCTAACAGCAAAGG + Intergenic
1048250246 8:132860008-132860030 ATGTTCTTTTCAAGCATCCATGG - Intergenic
1052698878 9:31913898-31913920 ATATTCATTTAAAACATCTAGGG + Intergenic
1052717841 9:32139287-32139309 ACATTCATTCCTAACATCTAGGG - Intergenic
1056334826 9:85557573-85557595 ATTTTCCTTTCTAATAGCTGTGG - Intronic
1056657276 9:88519907-88519929 ATCTTCATGTCTGACATCTATGG + Intergenic
1056769855 9:89469122-89469144 ATGTTCCTTTTTAATGTCTATGG - Intronic
1056866255 9:90229402-90229424 ATATTGTTTTCTAACATCCAGGG - Intergenic
1056916766 9:90753507-90753529 ATATTGTTTTCTAACATCCAGGG + Intergenic
1057183866 9:93045160-93045182 ATGTTCCTTACTCTCTTCTAAGG - Intergenic
1057922952 9:99113824-99113846 ATGTTCCATTTTGACAGCTATGG - Intronic
1060692442 9:125675758-125675780 ATGTTGCTGTCTAACTTCCAAGG + Intronic
1060783220 9:126429023-126429045 ATGTTCCTGTCTCAGATCTGGGG - Intronic
1061644686 9:131991325-131991347 ATGTTCCTATCTATTTTCTAAGG - Intronic
1186936443 X:14455209-14455231 CTGTTGCTTTCTACCTTCTATGG - Intergenic
1188059077 X:25577803-25577825 ATTTTCCTTTTTTACATGTAAGG - Intergenic
1189682384 X:43529905-43529927 AAGTTCCTTTTTGCCATCTAAGG - Intergenic
1197016890 X:121635756-121635778 ATGGGCCTTTTTAACATGTAAGG - Intergenic
1197253491 X:124238541-124238563 ATGTTCCTTTCTCAGAACTCTGG - Intronic
1200692769 Y:6323690-6323712 ATGTGTATTTCTAACATATATGG - Intergenic
1201042503 Y:9851036-9851058 ATGTGTATTTCTAACATATATGG + Intergenic