ID: 1021423854

View in Genome Browser
Species Human (GRCh38)
Location 7:20476278-20476300
Sequence TGTCCCTCCCTAACGGTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021423850_1021423854 18 Left 1021423850 7:20476237-20476259 CCTCATCTGCAAAATGAGAACAA No data
Right 1021423854 7:20476278-20476300 TGTCCCTCCCTAACGGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021423854 Original CRISPR TGTCCCTCCCTAACGGTGTG GGG Intergenic
No off target data available for this crispr