ID: 1021424108

View in Genome Browser
Species Human (GRCh38)
Location 7:20479834-20479856
Sequence AGAATGTATCTGGTAAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021424106_1021424108 -5 Left 1021424106 7:20479816-20479838 CCTGAATAAATTAATCTAAGAAT No data
Right 1021424108 7:20479834-20479856 AGAATGTATCTGGTAAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021424108 Original CRISPR AGAATGTATCTGGTAAAATA AGG Intergenic
No off target data available for this crispr