ID: 1021429648

View in Genome Browser
Species Human (GRCh38)
Location 7:20546284-20546306
Sequence ATCTGCCGGTAGAATAACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021429646_1021429648 5 Left 1021429646 7:20546256-20546278 CCATTTTTCAAAGTTTAACAGTA No data
Right 1021429648 7:20546284-20546306 ATCTGCCGGTAGAATAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021429648 Original CRISPR ATCTGCCGGTAGAATAACAA AGG Intergenic
No off target data available for this crispr