ID: 1021432233

View in Genome Browser
Species Human (GRCh38)
Location 7:20573182-20573204
Sequence TGGTGATGCAAAAACATAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021432233_1021432237 9 Left 1021432233 7:20573182-20573204 CCTTTTATGTTTTTGCATCACCA No data
Right 1021432237 7:20573214-20573236 CCTTCCAACCATATTTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021432233 Original CRISPR TGGTGATGCAAAAACATAAA AGG (reversed) Intergenic
No off target data available for this crispr