ID: 1021436622

View in Genome Browser
Species Human (GRCh38)
Location 7:20624862-20624884
Sequence CCGCCCTTGGCCTTTGCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021436614_1021436622 16 Left 1021436614 7:20624823-20624845 CCGCACAATGGAATCAGTTTCCT 0: 1
1: 0
2: 2
3: 21
4: 267
Right 1021436622 7:20624862-20624884 CCGCCCTTGGCCTTTGCCAAAGG No data
1021436613_1021436622 17 Left 1021436613 7:20624822-20624844 CCCGCACAATGGAATCAGTTTCC 0: 1
1: 0
2: 1
3: 9
4: 146
Right 1021436622 7:20624862-20624884 CCGCCCTTGGCCTTTGCCAAAGG No data
1021436618_1021436622 -4 Left 1021436618 7:20624843-20624865 CCTCTGGGCGCCTCAGGCTCCGC 0: 1
1: 0
2: 0
3: 28
4: 299
Right 1021436622 7:20624862-20624884 CCGCCCTTGGCCTTTGCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021436622 Original CRISPR CCGCCCTTGGCCTTTGCCAA AGG Intronic
No off target data available for this crispr