ID: 1021441644

View in Genome Browser
Species Human (GRCh38)
Location 7:20684327-20684349
Sequence TCTTTTCTTGAGAAGGTCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021441644 Original CRISPR TCTTTTCTTGAGAAGGTCGC TGG (reversed) Intronic
900527274 1:3135371-3135393 TCTTTTCTTGAGAAAATGTCGGG - Intronic
901294086 1:8147203-8147225 TTTTTTTTTGAGAAGGTGTCTGG - Intergenic
901549949 1:9988739-9988761 TTTTTTTTTGAGATGGTCGCAGG + Intergenic
902895162 1:19474681-19474703 TCTCCTCTTGTGAAGGTGGCAGG - Intronic
903045287 1:20559936-20559958 TTTTTTTTTGAGAAGGTCTCAGG + Intergenic
904727276 1:32559121-32559143 TCTTTTTTTGAGATGGTGTCTGG + Intronic
907821337 1:57972655-57972677 TCTTCTCTTGAGATGGCCTCAGG + Intronic
911547584 1:99238054-99238076 TCTATTCTTGAGAAGCTAGTGGG - Intergenic
912774242 1:112494569-112494591 TCTTTTGTAGAGAAGGGCCCAGG + Intronic
913013065 1:114703957-114703979 TTTTTTCTTGAAAAGGAGGCAGG - Intergenic
916765676 1:167858197-167858219 TCTGTTCTTAAGAAGCTCACAGG + Intronic
917863765 1:179173940-179173962 GGTTTTCTTGAGAAGGTAGGTGG - Intronic
918497149 1:185153610-185153632 TCTTTTTTTGAGAAGTTTGACGG + Intronic
921254965 1:213330770-213330792 TCTTTTCTTGAGAAGGTGAACGG + Intergenic
921423720 1:214978277-214978299 TCTTCTCTTGAGCAGGAGGCAGG - Intergenic
923677280 1:236090939-236090961 TCCTCTCTTGAGAGGGTCTCAGG - Intergenic
924037811 1:239954316-239954338 TCTTTTCCTGGGAAGGACACAGG + Intergenic
1068578518 10:58711624-58711646 TCTTCTCTTCTGAAGGTCCCAGG + Intronic
1071317745 10:84419342-84419364 TTTTTTTTTGAGAAGGGAGCTGG - Intronic
1076299156 10:129411661-129411683 ACTTTTTTTGAGAAGTTCTCTGG - Intergenic
1082642604 11:55683378-55683400 TCTTGTTTTGAGAAAGTCCCAGG - Intergenic
1087028342 11:93674633-93674655 ACTTTTCTTGAGAAAGCCGAGGG + Intronic
1089956556 11:122576652-122576674 TCTTTTGTTGAGTAGGTTCCTGG + Intergenic
1090158171 11:124463580-124463602 TTTGCTCTTGAGTAGGTCGCTGG - Intergenic
1092764270 12:11838659-11838681 TTCTTTCTTCAGAAGGACGCTGG + Intronic
1094556348 12:31503827-31503849 TGTTTTCTGGAGAAAGTCTCTGG - Intronic
1097472094 12:60006999-60007021 TTTTATCTTGAGAATTTCGCTGG - Intergenic
1099245403 12:80187887-80187909 TACTATCTTGAGAAGGTCACCGG + Intergenic
1100234625 12:92648359-92648381 TCTTTTCTTCAGCAGGTCTGAGG + Intergenic
1101834945 12:108288571-108288593 TCTTCTCTGGAGAAGGACCCAGG + Exonic
1106544540 13:30718630-30718652 GCCTTTTTTGAGAAGGTGGCAGG - Intronic
1106932643 13:34683352-34683374 TCTTTTCTTGAAAAATTTGCTGG - Intergenic
1109031362 13:57193876-57193898 TCCTATCTTTAGAAGGTCGCTGG - Intergenic
1109706042 13:66094217-66094239 TGTTTCCTTAAGAAGGTGGCTGG - Intergenic
1115026693 14:28755395-28755417 TCTTTTCTTGAGATGGGGACTGG - Intergenic
1116274605 14:42815524-42815546 TCTTTTCTGGAGAAAGTTCCAGG + Intergenic
1120529188 14:85611378-85611400 GCTTTTCTAGAGAGGGTTGCGGG + Intronic
1122360069 14:101153901-101153923 TCTATTCTTGTGAAGGTCTAGGG - Intergenic
1125159800 15:36629841-36629863 TATTTTCTTTAGGAGGTCCCTGG - Intronic
1126373022 15:47966897-47966919 TCATTTCTTGAGAACATGGCTGG + Intergenic
1127710088 15:61588733-61588755 TCTTTTCTTTATAAAGTCTCAGG - Intergenic
1128253525 15:66180330-66180352 GCCTTTCTTGAGAAGGTGACCGG + Intronic
1128896439 15:71377733-71377755 TCTTTTGCTGACAAGGTTGCAGG + Intronic
1129871099 15:78942225-78942247 TTTTTTTTTGAGAAGGAGGCTGG + Intronic
1130153894 15:81333214-81333236 TCTGTTCCTGTGAAGGTCACTGG + Exonic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1131452385 15:92554207-92554229 TCTGTTCTTGAGAATGTTCCAGG - Intergenic
1131913349 15:97233582-97233604 TCATTTTTGGAGATGGTCGCTGG - Intergenic
1132955496 16:2590758-2590780 TCTTTTATTGGGAAGGTATCAGG - Intronic
1133861593 16:9600231-9600253 TGTTTTCTTCAGAGGGTCCCAGG + Intergenic
1138320627 16:56108159-56108181 TCTTTTCTTGGAAAGGACCCAGG - Intergenic
1144174699 17:12694002-12694024 TCTTATCTTTGGAAGGTCGTGGG - Intronic
1144322739 17:14145903-14145925 TCTTTTCTCCAGAAAGTCGGAGG - Intronic
1147628686 17:41916383-41916405 TTTTTTTTTGAGAAGGACTCTGG + Intronic
1148653259 17:49264828-49264850 TCTTCCCTTGAGAAGCTCACAGG + Intergenic
1150137377 17:62703438-62703460 TCTTGTCTTGAGAACGGCTCTGG + Intronic
1155319053 18:24600656-24600678 TCATTTTTTGAGAGGGTCTCAGG - Intergenic
1156383729 18:36587138-36587160 TCTTTTCTGGAGATGGTGGGGGG + Intronic
1158249759 18:55474661-55474683 TCTTTTCTTGATCAGTTCCCAGG - Intronic
927005110 2:18840475-18840497 TATCTTCTTGAGAATGTAGCTGG + Intergenic
927274865 2:21254199-21254221 TCTTTCTTTGAGAAGGTGGAGGG + Intergenic
932017084 2:68040370-68040392 TTTTTTCTTAAGTAGGTCACTGG - Intergenic
932370985 2:71187665-71187687 TCTTTTCTTAAAAAGGAGGCTGG + Exonic
932647617 2:73520841-73520863 TCTTTTTTTGAGTAAGTAGCAGG + Intronic
937483011 2:122282264-122282286 TCCTTTCTTGAGAAGGTAATTGG + Intergenic
938668986 2:133569024-133569046 TCTTTTCCTGAGAAGAGTGCTGG + Intergenic
941543604 2:166817471-166817493 TCTTTTCTTAAGAAGTTCTGAGG - Intergenic
941606945 2:167609703-167609725 ACTGTTCTTGAGAGGGTCACTGG + Intergenic
941672168 2:168306105-168306127 TCTTTTCTTGATATGGTATCAGG + Intergenic
942428385 2:175883624-175883646 TCTTTTAATGAGAAGGGAGCTGG + Intergenic
943432917 2:187826534-187826556 TCTTTTGATGAGAAGGTCAGAGG - Intergenic
944073011 2:195694634-195694656 CCTGTTCTTGAGGAGGTAGCAGG + Intronic
944220840 2:197302770-197302792 TCCTTTCTTGAGAAAGTCTGTGG + Intronic
944922864 2:204433751-204433773 TCTTTTGTTGAGAAGGTTTGAGG - Intergenic
945612756 2:212025746-212025768 TCTTTTCTAGAAAAGGTCATGGG + Intronic
946168585 2:217880069-217880091 TCTTTTCTTGAGTTGGTCGTAGG - Intronic
946677078 2:222171477-222171499 TCTTTTCTTGATAAGTTACCTGG + Intergenic
1168737327 20:152705-152727 TCTTTTCTTGAGATAGTGTCTGG + Intergenic
1170548763 20:17457439-17457461 CCTTTTCTTGTGAAGGTAGAGGG - Intronic
1170790849 20:19508315-19508337 TTTTGTCATGAGAAGGTCACTGG + Intronic
1171282403 20:23911686-23911708 TTTTTTTTTGAGCAGGTCTCAGG - Intergenic
1172167754 20:32909203-32909225 AGTTTTCTTGAGAAGGTAGTGGG + Intronic
1178322869 21:31619017-31619039 TATTTTCTTCACAAGGTGGCAGG - Intergenic
1184249845 22:43253779-43253801 CCTCTTCCTGGGAAGGTCGCGGG + Intronic
949524614 3:4890994-4891016 TTTTTTCTTGAGACAGTCTCAGG - Intergenic
952337390 3:32415727-32415749 TCTTTTCTCCAGAAGTTAGCTGG + Intronic
953164584 3:40453471-40453493 TGTTTCCTTCGGAAGGTCGCAGG - Intergenic
953949261 3:47175773-47175795 TCTGTTTCTGAGAAGGTCTCAGG - Intergenic
956099906 3:65757253-65757275 TCTTTTCTATAGAAGGTCCCTGG - Intronic
956608670 3:71099628-71099650 TCTTATCTAGAGAATGTGGCTGG - Intronic
958480736 3:94643139-94643161 TCTTTTCTGGTGGAGGTGGCAGG + Intergenic
965486949 3:169289951-169289973 TCTCTTCTTGAGAAGGTACCAGG + Intronic
969912030 4:10456549-10456571 TCTTTCCTTGAGAGGGTCAGGGG - Intronic
972586348 4:40440281-40440303 TGTTTTCTTGAGGAGGTGGGAGG + Intronic
974776568 4:66490673-66490695 TCTTTTCTTGAGAAAATTGGTGG - Intergenic
977253437 4:94713953-94713975 TGTTTTTTTCAGAAGGTCCCAGG + Intergenic
977355083 4:95935637-95935659 TCTGTTCTTCACAAGGTGGCAGG - Intergenic
977515621 4:98017892-98017914 TATTTTCTTCACAAGGTAGCAGG - Intronic
978289379 4:107119221-107119243 GATTTTCCTGAGAAGGTGGCAGG - Intronic
981039024 4:140204113-140204135 TCTTTTTTTAAGAAGCTTGCTGG - Intergenic
983997614 4:174204660-174204682 TCTTTTCATCAGAAGGTCCATGG + Intergenic
984246667 4:177283205-177283227 TCTTATCTTGAGAAGGATGCTGG - Intergenic
984676348 4:182552267-182552289 TCTTTTGTAGAGATGGTGGCGGG - Intronic
985125178 4:186686243-186686265 TGTTTTCTTCAGAATGTCGGGGG - Intronic
985165399 4:187088867-187088889 TCATTTCTTGAGTTGTTCGCAGG - Intergenic
985964311 5:3328197-3328219 TCTTTTCATGAGAATCTTGCTGG - Intergenic
987015509 5:13814654-13814676 CCATTTCTTGAGACGGTGGCAGG + Exonic
989443624 5:41502983-41503005 TCTTTTCTTGAGAAAGGGCCAGG + Intronic
994546430 5:101172728-101172750 TTTTTTTTTGAGAAGGTGTCCGG + Intergenic
995443995 5:112222754-112222776 TCTTTTCTGGAGAAGGAATCTGG + Intronic
996905698 5:128597123-128597145 CCTTTTCTTGAGGAGGTAGGTGG - Intronic
1000511565 5:162189910-162189932 CCTTTTCTGGTGAAGGTGGCAGG + Intergenic
1001599155 5:172917775-172917797 TCTGTTGTTGAGGAGGTCCCAGG - Intronic
1005039705 6:21589577-21589599 TGTTTTCTTGAGAAAATCGAAGG + Intergenic
1011149171 6:84250156-84250178 TCTTTTTTTGAAAAGTTCCCTGG + Intergenic
1011885887 6:92094703-92094725 TCTTTTTTTGAAAAGGTCATTGG + Intergenic
1018625564 6:165775170-165775192 TATTTTCTTGATAATGTAGCTGG - Intronic
1021441644 7:20684327-20684349 TCTTTTCTTGAGAAGGTCGCTGG - Intronic
1027966156 7:85011318-85011340 TCTATTCTTGTCAAGGTCACCGG - Intronic
1032586651 7:133153058-133153080 TCTTTCCCTGAGAAGGACACAGG - Intergenic
1032588339 7:133169302-133169324 TCTCTTGATGAGAAGGTCGGAGG + Intergenic
1033444255 7:141406212-141406234 TCCTTTCTTAGGAAGGTCCCTGG + Intronic
1033445409 7:141417380-141417402 TTCTGTCTTGAGAAGGCCGCTGG - Intronic
1033959884 7:146901885-146901907 TTTTTTTTTGAGACGGTCTCTGG + Intronic
1035266569 7:157692923-157692945 TCTTTGCCCGAGAAGGTCCCTGG - Intronic
1035854795 8:2963253-2963275 TCCTCTCCTGTGAAGGTCGCGGG - Exonic
1036511226 8:9402201-9402223 TCTTTTCTTGGTATGGGCGCTGG + Intergenic
1037056420 8:14447265-14447287 TCTTTTCTTGCTAAAGTTGCTGG + Intronic
1043763943 8:84105254-84105276 TATTTTCTTCACAAGGTGGCAGG + Intergenic
1044690440 8:94871640-94871662 TCTTTTCTTCAGAATGTCAAAGG - Intronic
1045387482 8:101685850-101685872 TCTGATCCTGAGAAGGTGGCTGG - Intergenic
1046645474 8:116781324-116781346 TCTTTTTTTCAGAAGGTCCTGGG - Intronic
1056685006 9:88752146-88752168 TCTTCTCTTGAGAAGGTTCTGGG - Intergenic
1058290153 9:103230880-103230902 TTTGTTGTTGAGAAGGTGGCAGG - Intergenic
1062398618 9:136362858-136362880 TCTTGTATTGATAAGGTGGCTGG + Intronic
1186535361 X:10341633-10341655 TCTATTCTTGGGAGAGTCGCTGG - Intergenic
1186686923 X:11934969-11934991 TCTTTTCTTGTGAATGTTGAAGG + Intergenic
1187596949 X:20783763-20783785 TCTTATTTTGAAAAGGTCACAGG + Intergenic
1196770836 X:119291638-119291660 TCTTTTCTTTATAAAGTCTCAGG + Intergenic
1199056310 X:143299180-143299202 TCTTTTCTTTGGAAGGTGGAAGG - Intergenic
1200984052 Y:9287642-9287664 TCTCTTCTTGATAAGGTTGGGGG + Intergenic