ID: 1021442754

View in Genome Browser
Species Human (GRCh38)
Location 7:20697193-20697215
Sequence TGGCTAACCCACATTTATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021442754_1021442757 -1 Left 1021442754 7:20697193-20697215 CCAATATAAATGTGGGTTAGCCA 0: 1
1: 0
2: 0
3: 7
4: 70
Right 1021442757 7:20697215-20697237 ACCCTGAAAATGGACTTTAAAGG 0: 1
1: 0
2: 2
3: 14
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021442754 Original CRISPR TGGCTAACCCACATTTATAT TGG (reversed) Intronic
901296674 1:8166193-8166215 TGTCTAACCGACAGTTCTATGGG + Intergenic
918819374 1:189232409-189232431 TTCTTAACCCACATTTTTATGGG + Intergenic
1075166734 10:120074940-120074962 ATGCTAACTCACATTTACATAGG + Intergenic
1076447023 10:130522960-130522982 TGTCCAACTCACATTTATTTTGG + Intergenic
1079416911 11:20246171-20246193 TGTCTAACCCATATTTATAGGGG - Intergenic
1086992374 11:93318133-93318155 TGGCTCACTCACATATACATTGG - Intergenic
1092455503 12:8639132-8639154 TGACTCACTCACATTTACATAGG + Intronic
1098602795 12:72352580-72352602 TGCCTAGCCCAGATCTATATAGG - Intronic
1099286643 12:80720868-80720890 TGGATAACCCAGACTTATGTTGG - Intergenic
1109079597 13:57881633-57881655 TTGCTATTACACATTTATATAGG - Intergenic
1109766540 13:66907315-66907337 TTGCTAAATCAGATTTATATTGG + Intronic
1110972258 13:81780013-81780035 TGAGTCAGCCACATTTATATGGG + Intergenic
1202836313 14_GL000009v2_random:79765-79787 TTGCTAACTCACATCTCTATGGG + Intergenic
1124155643 15:27223146-27223168 GGGCTGACCCACATTAATATTGG - Intronic
1126972683 15:54135079-54135101 TGGCTAATACACATTTAAAAAGG - Intronic
1130422363 15:83760774-83760796 TGACTAAGCCAGATTTATTTTGG + Intronic
1141379146 16:83559939-83559961 TGAATAACCAACATGTATATTGG - Intronic
1149812079 17:59685483-59685505 TTGCAAAACCAGATTTATATTGG + Intronic
1153171745 18:2324641-2324663 AGGCCAACCCACATTGATAAGGG + Intergenic
1155416436 18:25604806-25604828 TGGCTGACCCACAGCTTTATGGG - Intergenic
1157938020 18:51894418-51894440 TGTCTAACCCTCTATTATATGGG - Intergenic
1159378403 18:67624628-67624650 TCGCTAACACACATGTACATAGG + Intergenic
1163940892 19:20492189-20492211 TGGGTAACCCACCTTTCTCTTGG - Intergenic
1202636327 1_KI270706v1_random:47600-47622 TTGCTAACTCACATCTCTATGGG - Intergenic
928011188 2:27609344-27609366 TGCAAAACCCACATTTAAATTGG - Intronic
930412475 2:51042830-51042852 TTGCTAACCCAGATATATTTTGG + Intergenic
946610877 2:221456277-221456299 TAGCTACCCTACATTAATATAGG - Intronic
1177001325 21:15617182-15617204 GGGTTAATACACATTTATATTGG - Intergenic
1177593256 21:23201462-23201484 TAGATAATCCACATTTTTATGGG + Intergenic
1180364539 22:11926716-11926738 TTGCTAACTCACATCTCTATGGG + Intergenic
1182542771 22:31053975-31053997 TGGGTGTCCTACATTTATATTGG + Intergenic
1184448158 22:44565760-44565782 TTGCCCACCCACATTTATAAGGG - Intergenic
955563701 3:60221935-60221957 GTGCATACCCACATTTATATAGG - Intronic
958060984 3:88480667-88480689 TGGCTTACTTACATTTCTATGGG + Intergenic
964513949 3:157485990-157486012 TGGCAAACCCAAAATTATAATGG + Intronic
964808147 3:160634254-160634276 TGACTAACCCACATTTCCCTGGG + Intergenic
968469161 4:770375-770397 TTGCAAACCCTCATTTAAATTGG + Exonic
980222303 4:129934677-129934699 TTGCTAATGCACGTTTATATAGG + Intergenic
980757335 4:137182541-137182563 TCACTAACCCAAATTTTTATTGG + Intergenic
982587439 4:157260311-157260333 TGATTAAGCCACAGTTATATGGG - Intronic
984769575 4:183425741-183425763 TGGCTAAGCCACAATTATTTGGG - Intergenic
984907637 4:184644109-184644131 TGGCTAACCACCATGTAAATAGG - Intronic
1202763643 4_GL000008v2_random:133467-133489 TTGCTAACTCACATCTCTATGGG - Intergenic
985980902 5:3462353-3462375 TGGCTAACTTACATTCATATTGG - Intergenic
988219227 5:28319844-28319866 ATGCTAACCTACAATTATATAGG + Intergenic
989693333 5:44170950-44170972 TTGCTGACCCACATCTATCTGGG + Intergenic
992098801 5:73386317-73386339 TGGCTCACTCACATGGATATTGG - Intergenic
997018539 5:129967178-129967200 TGCCCATGCCACATTTATATAGG + Intronic
999332115 5:150681557-150681579 TGGCTAAAACACATTTCTTTTGG - Intergenic
1000379691 5:160617650-160617672 TGGCAAAGCCACACTGATATGGG + Intronic
1001324316 5:170710255-170710277 TGTCAAACCCACTTTTAAATTGG + Intronic
1007910366 6:45507196-45507218 TGCCTCACCCAGAGTTATATTGG - Intronic
1008217114 6:48806374-48806396 TGGCCAGCCCACTTTTATTTGGG + Intergenic
1009506137 6:64482393-64482415 TGGCTAACTTACACATATATAGG - Intronic
1010040069 6:71370763-71370785 TGGCTTACCCAGGGTTATATAGG - Intergenic
1010274767 6:73956632-73956654 TGGCTAAGCCACCATTATTTGGG - Intergenic
1015572646 6:134637299-134637321 TTGCTCACTCACATTTAGATAGG - Intergenic
1018907453 6:168083734-168083756 TGGCAAACACACATCTATCTGGG + Intergenic
1021233491 7:18114342-18114364 TAGCTTTCCCACATCTATATTGG + Intronic
1021442754 7:20697193-20697215 TGGCTAACCCACATTTATATTGG - Intronic
1030746471 7:113172426-113172448 TGGATAATCTACTTTTATATGGG + Intergenic
1032955297 7:136963651-136963673 TGGCTAACCCATATCTCTAGAGG - Intronic
1037136628 8:15470399-15470421 TTACTAACCCACATTTTTAATGG - Intronic
1037247021 8:16846527-16846549 TGGCTAACATACATTTATAAAGG + Intergenic
1039655656 8:39402552-39402574 TTGTAAACCCACATTTATATAGG - Intergenic
1045122886 8:99057484-99057506 TACCTATCCCACATTTAAATAGG + Intronic
1045382592 8:101642269-101642291 TGGATAAACCACATTTATTTTGG - Intronic
1046383392 8:113478332-113478354 TGGCTAATTAACATTTTTATAGG - Intergenic
1050246896 9:3699764-3699786 TGGCTAACTCACACCTATAATGG - Intergenic
1051072719 9:13192088-13192110 AGGCTAACCTACATATATAATGG - Intronic
1058783116 9:108359228-108359250 TTGCTAACCCTGTTTTATATGGG - Intergenic
1059681265 9:116588793-116588815 TGGATTATCCACTTTTATATGGG + Intronic
1203544397 Un_KI270743v1:118340-118362 TTGCTAACTCACATCTCTATGGG - Intergenic
1189194434 X:39140790-39140812 TGACTAACTCTCATTTACATAGG - Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1192926459 X:75759554-75759576 TTGCTGACCCACATTTCTCTGGG + Intergenic
1196316634 X:114233766-114233788 TGGCAAACCCACATATATGGAGG - Intergenic
1197433084 X:126390492-126390514 TGGCTATCACACGTTTATTTGGG + Intergenic