ID: 1021443565

View in Genome Browser
Species Human (GRCh38)
Location 7:20708186-20708208
Sequence CTGTGGAAAAGTCATTTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 254}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021443565_1021443569 21 Left 1021443565 7:20708186-20708208 CCATGGAAATGACTTTTCCACAG 0: 1
1: 0
2: 1
3: 21
4: 254
Right 1021443569 7:20708230-20708252 CTGTTTTGTCTTGCAGTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021443565 Original CRISPR CTGTGGAAAAGTCATTTCCA TGG (reversed) Intronic
901954943 1:12777296-12777318 CTGTGGGAACCTCATCTCCATGG + Exonic
901972662 1:12920137-12920159 CTGTGGGAACCTCATCTCCATGG + Exonic
901975203 1:12938929-12938951 CTGTGGAAATCCCATCTCCATGG - Exonic
901982806 1:13050062-13050084 CTGTGGAAATCCCATCTCCATGG - Intronic
901986216 1:13077276-13077298 CTGTGGAAATCCCATCTCCATGG + Exonic
901995596 1:13149491-13149513 CTGTGGAAATCCCATCTCCATGG - Intergenic
901999283 1:13178856-13178878 CTGTGGAAATCCCATCTCCATGG + Intergenic
902009972 1:13262835-13262857 CTGTGGAAATCCCATCTCCATGG + Exonic
902012518 1:13281625-13281647 CTGTGGGAACCTCATCTCCATGG - Exonic
903223514 1:21882036-21882058 CTCTGGGAAAGTCAATGCCATGG + Intronic
904932493 1:34100817-34100839 CAGTGGAAAATGCCTTTCCACGG + Intronic
905847789 1:41247263-41247285 CAGTGGAAGAGTCAAGTCCATGG - Intergenic
906854963 1:49294139-49294161 TTTTGGAAAAGTCATTTAAAGGG + Intronic
910132460 1:83924851-83924873 TCTTAGAAAAGTCATTTCCAAGG + Intronic
911720851 1:101189765-101189787 TTTTGGAAAGGTCATGTCCAGGG + Intergenic
912548615 1:110469098-110469120 CTGTGTAAGAGACATTGCCAAGG + Intergenic
913685368 1:121226713-121226735 TTCAGGTAAAGTCATTTCCAAGG + Intronic
914037215 1:144014317-144014339 TTCAGGTAAAGTCATTTCCAAGG + Intergenic
914152240 1:145053615-145053637 TTCAGGTAAAGTCATTTCCAAGG - Intronic
916103328 1:161411654-161411676 CTGTGGAATTGTCATTTCAAAGG + Intergenic
918153148 1:181816205-181816227 CCCTGGGAAAGTCATTTCCATGG + Intergenic
920472686 1:206245271-206245293 TTCAGGTAAAGTCATTTCCAAGG + Intronic
922813849 1:228434991-228435013 CTGTGCAAATGACATTTGCAAGG + Intergenic
923005183 1:230043992-230044014 CTGTTGAAAAGTCATTCCTCTGG + Intergenic
923031083 1:230249445-230249467 CTGTGGAAAAGAAATCTCCAAGG - Intronic
923728399 1:236527444-236527466 CTGAGGATAATGCATTTCCAAGG + Intronic
923787713 1:237084163-237084185 CTGGGGTAATGTCCTTTCCACGG - Intronic
924485969 1:244484883-244484905 CTCTGGAAAAGTCATTTCTCTGG + Intronic
1062917473 10:1252411-1252433 CTGTGGAAGAGTCTTTCTCAAGG - Intronic
1064644131 10:17443581-17443603 CTGGGGAACATTCATATCCATGG - Intronic
1064848431 10:19682894-19682916 ATGGGGAAAAGTCATGTACATGG + Intronic
1066617403 10:37309215-37309237 TTGTGGGAAAGACAATTCCAGGG - Intronic
1069273138 10:66555816-66555838 CTGTCCAAAAGTTATTTCCAGGG - Intronic
1069971990 10:72179475-72179497 CTGAGGAAAAGTTATTTGAATGG - Intronic
1071748684 10:88450728-88450750 CTGTAAACAAGTCATTTCCAGGG - Intronic
1073086923 10:100897156-100897178 CTGAGGTAATGTCAATTCCAGGG + Intergenic
1073195373 10:101686577-101686599 CTAGGGAAAAGTCATTTTGAAGG - Intronic
1073610531 10:104938606-104938628 CTGTGCAGAAGTCAGTTCCAAGG + Intronic
1073629499 10:105134400-105134422 CTGTGAAAAATAAATTTCCATGG - Intronic
1074511793 10:114119282-114119304 CTGGGGAAAAGTTAGTTCTAAGG + Intergenic
1075015897 10:118909829-118909851 CTGTGGAAATGTCACCTACACGG + Intergenic
1075169808 10:120102800-120102822 CTCTGAAAAAGCCATTGCCATGG - Intergenic
1075216174 10:120538160-120538182 GTCTGGATAAGTCATTCCCATGG + Intronic
1076228832 10:128803116-128803138 TAGTGGAGAAGTCATCTCCAAGG + Intergenic
1079782471 11:24625153-24625175 GAGTGGAATAGTGATTTCCAGGG + Intronic
1079801204 11:24871518-24871540 TTGTGAAAAAGGCTTTTCCAGGG + Intronic
1081179594 11:39969395-39969417 ATGGGGAAAAGTCTCTTCCAAGG + Intergenic
1081652136 11:44831493-44831515 CTTTGGAAAAAGCATGTCCAAGG + Intronic
1081721384 11:45291298-45291320 TTGTTGAAAAGTCCATTCCAGGG - Intergenic
1081731260 11:45373341-45373363 GTGTGGAAATGTCAATCCCAGGG + Intergenic
1083013870 11:59431311-59431333 CTGAGGGAAATTCATTTCAATGG - Intergenic
1085212338 11:74792191-74792213 CTGTTGAAAAATTATTTTCAGGG + Intronic
1085949981 11:81318763-81318785 CTTTGGAAAAGATATTTACATGG - Intergenic
1086552901 11:88072925-88072947 CTGAGGAAAAGACAATTCCTGGG + Intergenic
1086608047 11:88720738-88720760 CTGTGCAAAAGCCATTTATATGG + Intronic
1086822395 11:91449861-91449883 CTGGGGAAAAATCATTTCAATGG + Intergenic
1087415348 11:97847827-97847849 CAGGAGAAAAGGCATTTCCATGG + Intergenic
1088984806 11:114896316-114896338 AAGTAGAAAAGTCATTTGCAAGG - Intergenic
1090342756 11:126040014-126040036 CTGTGTAAAAATCATAGCCAAGG + Intronic
1091062084 11:132473167-132473189 CTTTGGCAAAGCCATTCCCAGGG + Intronic
1092460135 12:8679122-8679144 CTCTGGAAAAATCATTTCTCAGG + Intergenic
1092749837 12:11708476-11708498 CAGTGGAAAAGTCCCTCCCAGGG - Intronic
1093893552 12:24552024-24552046 CTGTTAAAAAGTTATTTCCAAGG + Intergenic
1093999289 12:25677075-25677097 CTGTGGAACCATCATCTCCAAGG - Intergenic
1096544030 12:52324657-52324679 CTGTGGAAGTGACATTTCCATGG + Intergenic
1097147997 12:56954837-56954859 TTGTGGGGAAGTCTTTTCCAGGG - Intronic
1097624098 12:61978999-61979021 CTGTGTGAAATTCATTTTCACGG + Intronic
1097789015 12:63794298-63794320 CTGTGGAGAAACCATTTCCTTGG - Intronic
1098113524 12:67149850-67149872 ATGTTGAAAAATTATTTCCAAGG - Intergenic
1098711478 12:73768046-73768068 CTAGGGAAAGGTCATTTCCTAGG + Intergenic
1098804883 12:75011018-75011040 TTGTGGACATGGCATTTCCATGG - Intergenic
1099456414 12:82868362-82868384 CTGAGGAAAAGCCTTTTTCAAGG + Intronic
1100215401 12:92442544-92442566 ATGTGGGAAAGCCATTTCAAGGG + Intergenic
1102569683 12:113819821-113819843 CTCGGGAAAAGTCATTTGCCTGG - Intronic
1103377869 12:120470383-120470405 ATGTGGAAAAGTAAGTGCCAAGG - Intronic
1104290760 12:127464503-127464525 CTGTGGAATATTCACTTCCAGGG - Intergenic
1106870414 13:34012998-34013020 CTTTGGCAAATTCATTTCCGAGG + Intergenic
1109532585 13:63670109-63670131 CGGTAGAATAGTGATTTCCATGG + Intergenic
1109658889 13:65432536-65432558 CTGTGGATAAGACATTGACATGG - Intergenic
1110058931 13:71016184-71016206 CAGTGGAAAAGTGATGCCCAAGG + Intergenic
1110351909 13:74518932-74518954 TTGTGGAAAACTTATTGCCAGGG + Intergenic
1110359011 13:74604215-74604237 AGGTGGAAAAGTAATTTCTATGG + Intergenic
1111048117 13:82842922-82842944 CTGTGACAAATTCATTTCTATGG + Intergenic
1111260975 13:85739263-85739285 CTGTGTATAAGGCATGTCCATGG + Intergenic
1111540600 13:89662975-89662997 CTGAGGGAAAGTCATATCCTTGG - Intergenic
1112065898 13:95792745-95792767 CGGTGTAAAAATAATTTCCAAGG + Exonic
1112286573 13:98110090-98110112 CTTTAGAAATGACATTTCCAAGG - Intergenic
1112359709 13:98706416-98706438 CCGTGCAAAAGTCATTTCTGTGG - Intronic
1113273565 13:108702442-108702464 TTTTTGAAAAGTCATTTTCATGG - Intronic
1113443056 13:110344697-110344719 CTGTGGAGAAAGCATTTCTAAGG - Intronic
1113519784 13:110932011-110932033 CTGTAGAAATGTCATTTTCCTGG - Intergenic
1114053542 14:18944375-18944397 CTATTGAGAAGACATTTCCAAGG - Intergenic
1114109014 14:19457550-19457572 CTATTGAGAAGACATTTCCAAGG + Intergenic
1115160866 14:30392153-30392175 CTGTGGAAACGTGAATTCAAAGG - Intergenic
1116731958 14:48634487-48634509 CAGAGAAAAAGACATTTCCATGG - Intergenic
1117327632 14:54683938-54683960 CTTTGGAAAACTCTTTTCTATGG - Intronic
1117486664 14:56204674-56204696 CAGTTTAAAAGTCCTTTCCAGGG - Intronic
1118156919 14:63251438-63251460 CTGTGAAAAATTCTTTTCTATGG - Intronic
1118870517 14:69737344-69737366 AGGTGGAAAAGACATTCCCAGGG - Intronic
1119052438 14:71383478-71383500 CAGTGAAAAAGGCATTTCAAAGG - Intronic
1119793162 14:77372065-77372087 GTGTGGCAAAGTCATTACCATGG + Intronic
1202945748 14_KI270726v1_random:25082-25104 TTGTGGAAAAGTCATTTATTGGG + Intergenic
1123876353 15:24627633-24627655 CTGTGGTGACCTCATTTCCATGG + Intergenic
1124574113 15:30892659-30892681 CTGTGGAAAAATCGTTTCCCAGG + Intergenic
1125309637 15:38364777-38364799 CTCTGGAAAAGTGATGTTCAAGG + Intergenic
1127271220 15:57403593-57403615 GTGGGGAAAAGTAAATTCCATGG + Intronic
1129989379 15:79948879-79948901 CAGCTGAAAAGTCATTTCCTTGG - Intergenic
1130032101 15:80325306-80325328 CTGTGCAAATGACACTTCCAGGG - Intergenic
1132149575 15:99450053-99450075 CTGTGTAGAATTCCTTTCCAGGG - Intergenic
1133755321 16:8758337-8758359 CAGCTGAAAAGTCATTTCCCTGG - Intronic
1134082242 16:11333042-11333064 ATGTGGATAATTCATGTCCAGGG + Intronic
1135609014 16:23848560-23848582 CAGAGGAAAATTCATTTCTACGG - Intronic
1135629104 16:24022064-24022086 CTGTGGAAACCTGATTTCCAGGG + Intronic
1135941513 16:26826163-26826185 TTGTGGAAAAATCATTTTCAGGG + Intergenic
1137664101 16:50238388-50238410 CTTTGGAAAAGTCTTTTCTCGGG + Intergenic
1138966646 16:62092484-62092506 CCCTGGAAAAGTCATTTCTATGG + Intergenic
1140038501 16:71389744-71389766 CTGTTGAATATTCATTTCCTAGG - Exonic
1143274104 17:5697131-5697153 CTGAGAAAAAGTCATACCCAAGG + Intergenic
1143743269 17:8969936-8969958 TTGTGGAAATTTCATTTCAAAGG - Intergenic
1144238703 17:13288165-13288187 ATGTTGCAAAGTCATTTTCAGGG + Intergenic
1144273223 17:13639948-13639970 CTGGGGAAAACTCATTAGCAAGG - Intergenic
1144397624 17:14860527-14860549 CTCTTGAAAAGGGATTTCCAAGG + Intergenic
1147038358 17:37698739-37698761 CCATGGAAAAGGTATTTCCAAGG - Intronic
1147759479 17:42788159-42788181 CGGGGGAAAAGTCACTTCCAGGG - Exonic
1150652549 17:67019411-67019433 CTGTGGAAATCTCATTTGCTTGG - Intronic
1151079859 17:71316564-71316586 CTTTTGAAAAGTCGTTTCCCAGG - Intergenic
1151178200 17:72306290-72306312 CTAGGGAACAGTCATTTCCCTGG - Intergenic
1153216052 18:2821923-2821945 CTGTGGAAAACTCAGTTACAGGG - Intergenic
1153561431 18:6375465-6375487 CCGTGTAAATGTCATTTCCTTGG + Intronic
1153843866 18:9031178-9031200 CTATGGTAAAGTCATTTTAATGG + Intergenic
1156856516 18:41788532-41788554 ATGTGGAAAAGACATTCCCTGGG + Intergenic
1158285219 18:55873414-55873436 CTGTCTCAAAGCCATTTCCATGG + Intergenic
1158391939 18:57051414-57051436 CTACAGAAAAGTCACTTCCAGGG - Intergenic
1158743058 18:60165632-60165654 CTCTTGCAAAGTCATTTCCTGGG - Intergenic
1160269618 18:77372686-77372708 CTGGGAAAAAATCATTTTCATGG - Intergenic
1164779154 19:30878721-30878743 CTGTGGCAAAGTCATTGGAAGGG - Intergenic
1165520904 19:36313068-36313090 CTTTGGCAAAGTCATTTACCTGG - Intergenic
1165623168 19:37265518-37265540 CTTTGGCAAAGTCATTTACCTGG + Intergenic
1168355456 19:55697101-55697123 TTGTGGGAGAGTCATTTCCCAGG + Intronic
925679991 2:6410377-6410399 CTATGGTGAAGTCATTACCAAGG - Intergenic
926702257 2:15811379-15811401 CTCCGGAGAAGTCATTTCCCAGG - Intergenic
928090775 2:28373642-28373664 CTGTGCAAAAGCCAGTTGCAGGG - Intergenic
929982440 2:46694222-46694244 CCGAGGAAAAGTCATTTAAATGG + Intergenic
932442886 2:71749025-71749047 CTCAGGGAAAGTCATGTCCATGG + Intergenic
935929499 2:108108403-108108425 CTGAGCAAATTTCATTTCCATGG - Intergenic
936456050 2:112675171-112675193 ATGTGGAAAAGTGATCCCCAAGG + Intergenic
938047698 2:128137810-128137832 CTGGGGCAAAGGCATTTCAATGG - Intronic
941170321 2:162128025-162128047 CTGGGGAAATATCATTTCTAAGG + Intergenic
941618122 2:167746087-167746109 AAGTGGTAAAGTCATTTCAAAGG + Intergenic
941948288 2:171124261-171124283 ATGTGGTAAAGTCATTTCAGTGG - Intronic
942708501 2:178804406-178804428 CTATGGAAAGGTCATTTTAAGGG - Intronic
948271496 2:236677341-236677363 GTGTGGAAAGGCCATTTCAAGGG + Intergenic
1174772414 20:53313227-53313249 ATGTGGAAAATGCATTTACATGG - Intronic
1178236401 21:30847094-30847116 GGGTGGAAATTTCATTTCCAGGG + Intergenic
1178763594 21:35428276-35428298 CAGTTAAAAAGTCATCTCCAAGG - Intronic
1178941809 21:36912912-36912934 CAGAACAAAAGTCATTTCCAAGG + Intronic
1180472012 22:15666756-15666778 CTATTGAGAAGACATTTCCAAGG - Intergenic
1182437265 22:30338751-30338773 CTCTAAAAAAGTCAGTTCCAGGG + Intronic
1184507005 22:44909975-44909997 CCTTGGAAAACTCACTTCCATGG - Intronic
950206990 3:11088479-11088501 ATGGCGAAAAGTCATTTCCCTGG - Intergenic
950703188 3:14764635-14764657 CTGGGGCTAAGTCATCTCCAAGG + Intronic
951184588 3:19698055-19698077 CTGTGGAATAGTGGTTTCCAGGG + Intergenic
952091482 3:29892080-29892102 CTGCAGAAAAGTCATCTTCAGGG - Intronic
952178540 3:30893756-30893778 CTGCGGATCAGTCATTTTCAGGG - Intronic
954371721 3:50172483-50172505 CTGGGGAAAAGTCCTTCCTAAGG - Intronic
954512141 3:51134742-51134764 GTGTGGAAAATTCGGTTCCATGG - Intronic
957620562 3:82587651-82587673 CTGTGGAGAACTCAGTCCCATGG + Intergenic
959575189 3:107926167-107926189 CTGTGTAAATGGCATTTCCTCGG + Intergenic
960467499 3:118015169-118015191 CTTTTGAAAAGTCATTTCCAAGG + Intergenic
960820931 3:121730572-121730594 CTGTGGAAAAGGAATAGCCAAGG + Intronic
961051190 3:123748340-123748362 ATGTTGAAACGTGATTTCCAAGG - Intronic
961235016 3:125358601-125358623 ATTTGGAAAGGTCATTTTCAAGG - Intronic
962487059 3:135853936-135853958 CAATGGAAAGTTCATTTCCAAGG - Intergenic
963202032 3:142596145-142596167 CTGTGCTAAACTCATTCCCAGGG + Intergenic
963766374 3:149340288-149340310 CTGTTAAAAAGTCATATTCATGG - Intergenic
972403177 4:38723942-38723964 CAGAGGAAAAGTCACTTCCTGGG + Intergenic
972442815 4:39113223-39113245 GTGTGGAAAGGTAATTTCCTGGG + Exonic
972949105 4:44296368-44296390 GTATGGGAAGGTCATTTCCAAGG - Intronic
974461647 4:62196200-62196222 TTCTGTAAAAATCATTTCCATGG - Intergenic
974505526 4:62765927-62765949 CTGTGAAATAGTGATTTCCTTGG - Intergenic
974505631 4:62767466-62767488 CTGTGAAATAGTGATTTCCTTGG - Intergenic
975439597 4:74395813-74395835 CTATGGAAAAGAGATTTCCTGGG + Intergenic
976063865 4:81161547-81161569 CAGGGGAAAATTCATTTTCAAGG + Intronic
976465004 4:85357212-85357234 CTGTGGAAAGATCATTGCCTAGG - Intergenic
981495082 4:145382034-145382056 CTGGGGAAAGGTAACTTCCAAGG - Intergenic
982604204 4:157493198-157493220 CAGAGGAAAACTCATTGCCAAGG + Intergenic
983195446 4:164801241-164801263 CTGTGGATAAGTAGTTCCCATGG - Intergenic
985052135 4:186001478-186001500 CGGTGGGAAACTCATTCCCAGGG - Intergenic
986176821 5:5359666-5359688 AAGTGTAAAAGTCTTTTCCAAGG + Intergenic
986604731 5:9510067-9510089 CGGTGGAAAAATTAATTCCAGGG + Intronic
987283100 5:16430095-16430117 CTGGGGAAAAGATCTTTCCATGG + Intergenic
988546742 5:32164741-32164763 GTGTGGTAATGTCATTGCCAAGG - Intronic
988831885 5:34995933-34995955 CTTCTGAAAAGGCATTTCCAAGG + Intergenic
989094981 5:37773457-37773479 CTGGGGATGAGACATTTCCAGGG + Intergenic
991776556 5:70090918-70090940 CTCTGGAAAAATAATTTGCATGG + Intergenic
991855843 5:70966365-70966387 CTCTGGAAAAATAATTTGCATGG + Intergenic
991869858 5:71099143-71099165 CTCTGGAAAAATAATTTGCATGG + Intergenic
993115268 5:83713023-83713045 CTGTGGCAAACTCATTTATATGG + Intronic
993323389 5:86503796-86503818 CTTTACAAAAGCCATTTCCATGG - Intergenic
994858673 5:105159669-105159691 CTCTGGGAAAGTCTTTTCCCTGG - Intergenic
997011063 5:129878347-129878369 CTGAGGAAAAATCATGCCCATGG - Intergenic
998601034 5:143585289-143585311 GTGTTGAAAAGTCATTTATATGG - Intergenic
1001087594 5:168712326-168712348 CGCTGGAAATGTCATTGCCATGG + Exonic
1003819425 6:9879160-9879182 TTGTGCAAAAGTCAGTTCCTGGG - Intronic
1004601221 6:17151761-17151783 CTGTGGAAATGGCAATTCCCTGG - Intergenic
1005280371 6:24267638-24267660 CTGTGGAGATCCCATTTCCAGGG - Intronic
1007855265 6:44849162-44849184 CTATAGAAAAGTCATATACATGG - Intronic
1008217673 6:48814865-48814887 CTGCAGAATAGTCATTACCAGGG - Intergenic
1008318692 6:50079890-50079912 ATGTGGCACAGTCACTTCCATGG + Intergenic
1014002270 6:116377918-116377940 CTGGGGAAAAATCTTTTCCTGGG + Intronic
1014084697 6:117329802-117329824 CTTTGGAAAAGCAATTTCCCCGG - Intronic
1014194719 6:118541164-118541186 CTTTGGCAAAGTCATTTGTAAGG - Intronic
1015949215 6:138534646-138534668 TTTTGGAAAACTGATTTCCATGG - Intronic
1018441681 6:163819845-163819867 CTGCGGAGAAGCCTTTTCCACGG - Intergenic
1018713561 6:166514617-166514639 CTGTGTGAAAGTCCTGTCCATGG - Intronic
1019310661 7:359117-359139 GTCTGGAAAAGTCTTTTGCAGGG + Intergenic
1020566176 7:9798590-9798612 TTGAGGAACAGTTATTTCCAAGG - Intergenic
1021161717 7:17281599-17281621 CTTTGGAATTGTCATTTCAATGG + Intergenic
1021443565 7:20708186-20708208 CTGTGGAAAAGTCATTTCCATGG - Intronic
1023247746 7:38223750-38223772 TTATTGAAAAGTCATTGCCAGGG + Intronic
1023503361 7:40874232-40874254 CTTTGGATGAGTCATTTCCTTGG - Intergenic
1024477996 7:49834296-49834318 CAGTGGCTAATTCATTTCCAGGG + Intronic
1026102113 7:67391998-67392020 CAGTGGAAACATCATTTTCATGG - Intergenic
1027829473 7:83159965-83159987 ATGTGGAAAAATCAGTTCAATGG - Intronic
1027941391 7:84685552-84685574 CTGTGTAAATGTCCTTTCCAAGG - Intergenic
1028035428 7:85975811-85975833 TTCTGGAAGAGACATTTCCAAGG - Intergenic
1028194675 7:87892295-87892317 CTGTGGAAAAGGCAAAACCATGG - Intronic
1028298761 7:89170085-89170107 CTGTGGAATAGTTATTTAGAAGG + Intronic
1028870499 7:95766331-95766353 CTGTATAAAGGTAATTTCCAAGG - Intergenic
1029100600 7:98126824-98126846 CTGTTCAAAAGTGATTTTCAAGG - Intronic
1031397209 7:121287411-121287433 CTTTGGAAACCTCTTTTCCATGG - Intronic
1033585304 7:142770448-142770470 CAGTGGGAAAGTCAAATCCAAGG - Intergenic
1034990832 7:155547225-155547247 CTGTGCCAAAGTCATGTCCTGGG - Intergenic
1035079706 7:156205654-156205676 CAGTGGAAAAGTGGTTTCCTGGG + Intergenic
1035109974 7:156473327-156473349 CTGTGTAAAAGTGATTTACTAGG - Intergenic
1035778163 8:2205887-2205909 CAGAGGAAAAGTCATTTAGAGGG + Intergenic
1036586658 8:10130567-10130589 TTGTGGACAAGACATTTCGACGG + Intronic
1036949451 8:13127424-13127446 ATCTGTAAAAGTCATTTTCATGG - Intronic
1037030083 8:14093784-14093806 GTTTAGAAAAGTTATTTCCAAGG - Intronic
1037362580 8:18089527-18089549 CTGTGAAAAAGTCCTTTTCGAGG + Intergenic
1038842311 8:31196406-31196428 CTGTAGAAAAGTTATCTCAAAGG + Intergenic
1039155526 8:34552494-34552516 CTGTAGAATTGTCGTTTCCATGG + Intergenic
1041975054 8:63789391-63789413 CTGTTGAAAGATCATTTTCAAGG - Intergenic
1042387010 8:68188420-68188442 CTGGGGAAAATTCATTTTAATGG - Intronic
1042410215 8:68457692-68457714 CTGAGGAAAAGCTATTTGCAAGG + Intronic
1043664853 8:82796434-82796456 CAGAGGAAAGATCATTTCCATGG + Intergenic
1044549863 8:93499890-93499912 CTGTGGCAAAGTCTTTTTTACGG + Intergenic
1044777191 8:95702501-95702523 CTGTGGTGATGTCATTTTCAAGG + Intergenic
1046018619 8:108636526-108636548 CTCAGGGAAAGTCATTCCCAAGG - Intronic
1046291312 8:112165672-112165694 TTGTGTAATAGTCACTTCCAGGG + Intergenic
1047982208 8:130194915-130194937 ATGTGTAACAGTCATCTCCAAGG + Intronic
1048707617 8:137171229-137171251 ATGTGCAAAAGACATTTCAAAGG - Intergenic
1048803344 8:138215456-138215478 CTATGTAATAGTTATTTCCAGGG - Intronic
1049403886 8:142443127-142443149 ATTTGGAAAAGTCTTCTCCAGGG - Intergenic
1049775371 8:144401492-144401514 CTTTGGCAACGTCATGTCCATGG - Exonic
1050015888 9:1234043-1234065 CTGAGGAAAAGTAATATCCATGG - Intergenic
1050667811 9:7961063-7961085 CTCTGGAAAAGGAATTTCCTGGG + Intergenic
1050707746 9:8422527-8422549 CTGTAGAGAAGACATTTTCAGGG - Intronic
1051789128 9:20779857-20779879 ATGTGCTAAAGCCATTTCCAAGG - Intronic
1052013070 9:23433842-23433864 TTTTTGAAAAGTAATTTCCATGG + Intergenic
1052430122 9:28355417-28355439 CTGGGGAAAAAACTTTTCCAAGG - Intronic
1054937244 9:70700931-70700953 TTGTGGAAAAGTCATTGCTGGGG - Intronic
1057541592 9:95977871-95977893 AGAAGGAAAAGTCATTTCCAAGG + Intronic
1058048091 9:100378884-100378906 CTGTTAAAAAGTCATTTTGAAGG + Intergenic
1060455877 9:123796065-123796087 CTGTTGAAAAGTATTTTCCTGGG - Intronic
1062043748 9:134415779-134415801 CGGTGGGAAGGGCATTTCCAGGG + Intronic
1185663375 X:1744710-1744732 ATGGGGAAAAGTCCCTTCCAAGG + Intergenic
1186430859 X:9503266-9503288 CTGTGGAAAAGCAGTTTCCCCGG - Intronic
1188815590 X:34709658-34709680 CTGTGAAAAACTGCTTTCCAAGG + Intergenic
1193921762 X:87436651-87436673 CTGAGGAAAAGTTATTTTGAGGG + Intergenic
1194353736 X:92855451-92855473 CTGTGGAGAAGACTTTTCAAGGG - Intergenic
1195530499 X:105949576-105949598 CTGTGGTATAATGATTTCCAGGG - Exonic
1195994189 X:110714901-110714923 TTGTAAAAACGTCATTTCCATGG + Intronic
1196748563 X:119094059-119094081 GTGTGGTTCAGTCATTTCCAGGG - Exonic
1198132820 X:133715612-133715634 CTGTGCAAAAGCCTTTTCCCTGG + Intronic
1198575154 X:138002371-138002393 CTGTGTGGAAGTCATCTCCATGG - Intergenic
1200662097 Y:5972523-5972545 CTGTGGAGAAGACTTTTCAAGGG - Intergenic