ID: 1021446140

View in Genome Browser
Species Human (GRCh38)
Location 7:20735735-20735757
Sequence CCTTGCAGTGGAAAGCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 168}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021446140_1021446149 10 Left 1021446140 7:20735735-20735757 CCAGCCAGCTTTCCACTGCAAGG 0: 1
1: 0
2: 1
3: 19
4: 168
Right 1021446149 7:20735768-20735790 AGGGGAAAACACAGAGAGGAAGG 0: 1
1: 0
2: 13
3: 123
4: 980
1021446140_1021446146 -8 Left 1021446140 7:20735735-20735757 CCAGCCAGCTTTCCACTGCAAGG 0: 1
1: 0
2: 1
3: 19
4: 168
Right 1021446146 7:20735750-20735772 CTGCAAGGAAGACCATGTAGGGG No data
1021446140_1021446145 -9 Left 1021446140 7:20735735-20735757 CCAGCCAGCTTTCCACTGCAAGG 0: 1
1: 0
2: 1
3: 19
4: 168
Right 1021446145 7:20735749-20735771 ACTGCAAGGAAGACCATGTAGGG 0: 1
1: 0
2: 0
3: 9
4: 164
1021446140_1021446148 6 Left 1021446140 7:20735735-20735757 CCAGCCAGCTTTCCACTGCAAGG 0: 1
1: 0
2: 1
3: 19
4: 168
Right 1021446148 7:20735764-20735786 ATGTAGGGGAAAACACAGAGAGG 0: 1
1: 1
2: 4
3: 32
4: 337
1021446140_1021446144 -10 Left 1021446140 7:20735735-20735757 CCAGCCAGCTTTCCACTGCAAGG 0: 1
1: 0
2: 1
3: 19
4: 168
Right 1021446144 7:20735748-20735770 CACTGCAAGGAAGACCATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021446140 Original CRISPR CCTTGCAGTGGAAAGCTGGC TGG (reversed) Intronic
900552923 1:3265488-3265510 CCTGGCAGCGAAAAGCAGGCAGG - Intronic
902640942 1:17765760-17765782 CCTTGCAGGGCAGAGCTGACTGG + Intronic
903029767 1:20455411-20455433 CCTTCCAGTGGAAACAAGGCAGG - Intergenic
903118687 1:21199002-21199024 CTTAGGGGTGGAAAGCTGGCAGG + Intergenic
904756935 1:32773140-32773162 TCTTGAAGTGGGTAGCTGGCGGG + Exonic
906311460 1:44757476-44757498 CTCTGCAGTGGAAGGGTGGCAGG + Intronic
906430518 1:45752036-45752058 CCTTTCAGTGTAAGGCTGGACGG + Intergenic
909615992 1:77608310-77608332 CTTTTCAGTGGAAAGCTCACAGG + Intronic
910547550 1:88434823-88434845 CTTTTCAGTGGAAATCTTGCAGG + Intergenic
911187600 1:94919087-94919109 CCTTGAAATGAAAATCTGGCTGG + Intronic
920222934 1:204417327-204417349 CCTTCCATTGGCAAGCTGACTGG + Intergenic
1062814956 10:492410-492432 GCTTGCACTGGAAATGTGGCAGG - Intronic
1063186735 10:3658737-3658759 CCTTCCAGTGAAGAGCTGCCTGG + Intergenic
1063187896 10:3666765-3666787 CCCTGCAGTGCAAAGCTGGGTGG - Intergenic
1063309652 10:4940310-4940332 CTTTCCAGTGGAAACCTGACAGG - Intronic
1064556214 10:16549673-16549695 CCTGAGAGTGGAAAGCAGGCTGG + Intergenic
1065381330 10:25094360-25094382 CCTTTCAGTGGAAACCTTACAGG - Intergenic
1071568779 10:86685173-86685195 CATTGCAGTGGTAAGGAGGCAGG - Intronic
1071773287 10:88754373-88754395 CTTAGCAGGGGAAGGCTGGCTGG + Intergenic
1071886637 10:89958438-89958460 ACTTGCAGTCGAAGTCTGGCTGG + Intergenic
1071963077 10:90824921-90824943 CCCTGAAGGGGAAGGCTGGCTGG + Intronic
1076898787 10:133326977-133326999 CCGTGCGGTGGGCAGCTGGCAGG + Exonic
1079038228 11:17039188-17039210 CTTTGCAGTGGAAACCTTACGGG + Intergenic
1080859139 11:36138110-36138132 CCTTGCAGAGGACAGCCTGCTGG - Intronic
1081834687 11:46143857-46143879 ACTTCCAGGGGAAAGCTGGGGGG + Intergenic
1083732172 11:64658417-64658439 CTCTGCAGGGGAAAGCAGGCTGG - Intronic
1087803565 11:102531259-102531281 CCATACAGGGGAAAGATGGCAGG + Intergenic
1088123668 11:106398168-106398190 CCTTGCAGTGCCCAGCAGGCTGG + Intergenic
1089303685 11:117513932-117513954 CGTGGCAGTGGAAGGCTGGGTGG - Intronic
1095544734 12:43352287-43352309 CATGGCAGAGGAAACCTGGCAGG - Intergenic
1098329801 12:69341275-69341297 ACTTGCAGGGGACAGCTGGAGGG + Intergenic
1101453512 12:104805308-104805330 CCTTGCTGTGGATTGCTGACTGG - Exonic
1103032762 12:117630664-117630686 CCCAGCAGTGGAAAGGTGGATGG + Intronic
1103033764 12:117640043-117640065 CCTTGCTGTGCAATGTTGGCTGG - Intronic
1105754223 13:23449999-23450021 CCTTGCACAGGAAAGCTGTATGG + Intergenic
1106181853 13:27376133-27376155 CCGTACTGTGGAAAGCAGGCGGG - Intergenic
1106186632 13:27415535-27415557 TCTTGCAGTGGAGGGCTGGATGG - Intergenic
1108067371 13:46592106-46592128 CCTTCCAGTGGAAAGATGGTAGG - Intronic
1109112572 13:58340872-58340894 CCTTTCAGTGGAAACCTTACAGG - Intergenic
1111987346 13:95078512-95078534 CTTTGCACTGGGAAGGTGGCAGG + Intronic
1112614219 13:100986953-100986975 CCTTACAGAGGACAGCTGGCTGG + Intergenic
1112660745 13:101504738-101504760 CCTTGCAAATGATAGCTGGCTGG + Intronic
1113200909 13:107867054-107867076 CCTGGCAGGGGAGAGCGGGCTGG - Intergenic
1113379239 13:109787078-109787100 CCTTGCAGTGGAAGCATGGGCGG + Intergenic
1113667688 13:112152375-112152397 CCCTGCAGTGGACATTTGGCTGG - Intergenic
1114271153 14:21101069-21101091 CCTGGCAGAGGAAGGCTGTCAGG - Exonic
1116154893 14:41190691-41190713 CTTCTCAGTGGAAAGCTGACAGG + Intergenic
1116239556 14:42323531-42323553 TCTTGCATTAGAAAACTGGCAGG + Intergenic
1116595595 14:46840439-46840461 CAATGCATTGGAAAACTGGCTGG + Exonic
1116700016 14:48229259-48229281 CTTTGCAATGGCAGGCTGGCAGG + Intergenic
1117490015 14:56237306-56237328 CCCTGTAGTGGAAAGCAGACAGG - Intronic
1119637127 14:76282922-76282944 AGTTCCAGTGCAAAGCTGGCAGG - Intergenic
1121890835 14:97588957-97588979 CCATGCTGTGGTAAGCTTGCAGG - Intergenic
1122133728 14:99620677-99620699 CCTTCCTGTGGAAAGCTGGTAGG - Intergenic
1127901676 15:63345652-63345674 TCTGGCAGTGCACAGCTGGCCGG - Intronic
1128369295 15:67028369-67028391 GCTTTCAGTGGAAAGCAGTCTGG + Intergenic
1128592557 15:68914021-68914043 CCTTGCAGTTGAAATCTCACTGG - Intronic
1128868266 15:71132888-71132910 CCTTGTATTGGAAAGCAGGAAGG + Intronic
1129302429 15:74633107-74633129 CCTAGGAGTTGCAAGCTGGCTGG + Intronic
1129942914 15:79513853-79513875 CCTGGCAGTGGAGTGCTGCCAGG + Intergenic
1131473114 15:92713532-92713554 ACTTGCAGGGGAAGGCTGGTCGG + Intronic
1134189680 16:12111548-12111570 CCTTGCAGTGGGAAGGGGCCGGG - Intronic
1136655567 16:31707119-31707141 CCTTGCAGGGCAAACCTGACGGG - Intergenic
1138528097 16:57620373-57620395 CCTAGCACCGGGAAGCTGGCAGG + Intronic
1140055824 16:71524784-71524806 CCTAGCACGGGAAAGATGGCAGG + Intronic
1140316676 16:73904990-73905012 CCTTGCAGTGTAAAACAGCCTGG + Intergenic
1142141618 16:88475240-88475262 CCATGCAGTGGGCACCTGGCAGG + Intronic
1144356492 17:14451650-14451672 CCTTGCTGGGGAAAGATGTCTGG + Intergenic
1145200733 17:20942246-20942268 CCCTGCAGTGGAAGGGTGTCAGG - Intergenic
1145985614 17:29043981-29044003 CACTGCAGTGGATAGCTGGGTGG - Intronic
1152212153 17:79008443-79008465 CCTTACACTGGAGAGCTAGCCGG + Intronic
1152245989 17:79184794-79184816 CCTGGCAGTGGGGAGATGGCTGG + Intronic
1153846612 18:9055846-9055868 CCCTGTAGTGGATACCTGGCAGG - Intergenic
1159312381 18:66725975-66725997 CTTTGCTTTGGTAAGCTGGCTGG - Intergenic
1160272187 18:77397240-77397262 CCCTGCTGTGGAGAGCTGCCTGG + Intergenic
1160532775 18:79575256-79575278 CCTTGCAGAGGTCACCTGGCAGG - Intergenic
1163664243 19:18595548-18595570 CCTTGCAGTGAAACCCTGGGGGG + Intronic
1164914933 19:32044936-32044958 ACTTCCAGTTGACAGCTGGCAGG - Intergenic
1166701725 19:44886065-44886087 CCTGGCAGGGAGAAGCTGGCTGG + Intronic
1167448971 19:49556155-49556177 CCTTGCAGGAGAAAGCGGGGGGG + Intronic
926240300 2:11080292-11080314 ATTTGCAGTGGAAAGCAGGCTGG + Intergenic
931426529 2:62176946-62176968 CTTCACAGGGGAAAGCTGGCTGG - Intergenic
931500834 2:62864243-62864265 CGTTGCAGTGGAAGGATGGCTGG - Intronic
933632784 2:84675518-84675540 ACTTGCAGTGGAGAGCTGGAAGG - Intronic
937932729 2:127219278-127219300 CCTGGGAGTGGAGAGCTGGCGGG - Intronic
938492859 2:131775130-131775152 CTTTTCATTGGAAACCTGGCAGG + Intergenic
938897037 2:135762713-135762735 CCTTGAGGTGAAAAGCAGGCTGG + Intronic
939564124 2:143766518-143766540 CCATTCAGTGGAAAGGTGGAAGG + Intronic
941036899 2:160578722-160578744 CCTTGAAGAAGAAAGCTGCCAGG - Intergenic
941191237 2:162385397-162385419 CCTTGTAGTAAAAGGCTGGCAGG + Intronic
943738603 2:191386115-191386137 CCTTGCAGGGGTAACTTGGCAGG - Intronic
945332241 2:208553010-208553032 CCCTTCAGCGGAAAGCTGGGAGG + Intronic
1170152979 20:13244866-13244888 CCTTCCAATAGAAAACTGGCAGG - Intronic
1170586895 20:17741533-17741555 CCTGGCAGTGGAAGGTGGGCCGG + Intergenic
1172109894 20:32538564-32538586 CCTCTCACTGGAATGCTGGCGGG - Intronic
1173099104 20:40067199-40067221 CTTTTCAGTGGAAACCTGACAGG + Intergenic
1173952551 20:47004962-47004984 CATGGCTGTGGAAGGCTGGCGGG - Exonic
1175907646 20:62389194-62389216 CTTTTCAGAGGAAAGCTGCCTGG + Exonic
1178204234 21:30444365-30444387 TCTAGCAGAAGAAAGCTGGCTGG - Intergenic
1180901312 22:19375429-19375451 CCTTGAAGTGGGAAGGTGGCTGG - Intronic
1181442069 22:22941835-22941857 CCTTGCTGTGGGAGGCTGGGGGG + Intergenic
1184359391 22:44005673-44005695 CCATGCAGTGGAAAGGTGGGAGG - Intronic
949235905 3:1807840-1807862 CCTTGCAGTGCTAATCTGGTTGG - Intergenic
950454848 3:13086572-13086594 GAGTGCAGTGGGAAGCTGGCGGG - Intergenic
950800474 3:15547998-15548020 CTTTGCAGTGGAAACCTTACAGG - Intergenic
950887095 3:16372112-16372134 ACTTGCACAGGAAAGCTTGCAGG - Intronic
951802927 3:26616694-26616716 CCTTGCAGTTGGAAGCTGTGTGG + Intergenic
952655802 3:35783976-35783998 GCATGCAGTGGAAAGCTTCCAGG - Intronic
953797203 3:45995059-45995081 CCGTGCTGTTGAAACCTGGCGGG - Intronic
954384646 3:50237701-50237723 ACTTCCAGTGGGAAGCTGGATGG - Intronic
956745972 3:72311258-72311280 CCTTTCTGTGGACAGCTGGTGGG - Intergenic
957791654 3:84949604-84949626 CTTTGCAGATGAAAGATGGCGGG - Intergenic
960848557 3:122028029-122028051 CCAAGAAGTGGAAAACTGGCCGG + Intergenic
961325780 3:126108482-126108504 CCTTGCAGTGCAAGGATGGCCGG - Intronic
962944285 3:140153374-140153396 CCTTGCAGTGAGAATTTGGCGGG + Intronic
963114978 3:141720211-141720233 CCTTGCACTGGACTGCTGACTGG - Intergenic
964208870 3:154206223-154206245 CTTTTCAGTGGAAAGCTTACAGG - Intronic
964759170 3:160117112-160117134 CCTTTCAGTGGAAAGCTTATGGG + Intergenic
967659937 3:192093955-192093977 CTTTTCAGTGGAAACCTTGCTGG + Intergenic
970818605 4:20187585-20187607 CCTAGGAGTGGCAAGTTGGCAGG - Intergenic
972125289 4:35758000-35758022 ACTCTCAGTGGAAACCTGGCAGG - Intergenic
972232581 4:37092978-37093000 TCTTGCAGTGGAAAACAGGCAGG - Intergenic
972468481 4:39381805-39381827 CTTTGCAGTGGAAACCTTACAGG - Intergenic
977683528 4:99821387-99821409 CCATGCAGTGGAAAGCTCTGGGG - Intronic
979655369 4:123186759-123186781 GTGTGCAGTGTAAAGCTGGCGGG + Intronic
982216402 4:153086141-153086163 CCTTGCAGTAGAAATCTCCCTGG + Intergenic
985691211 5:1313708-1313730 CCTCTCAGTGGAAACCAGGCGGG - Intergenic
986751745 5:10793858-10793880 CTTTGCCTTGGAAAGCTGGTTGG + Intergenic
986756529 5:10841542-10841564 CTTTTCAGTGGAAACCTGACAGG + Intergenic
988730722 5:33970199-33970221 CTGTCCAGTGCAAAGCTGGCCGG - Intronic
989600048 5:43192452-43192474 CCTAGCAGAGGAAGGGTGGCGGG - Intronic
990573737 5:57104944-57104966 CCTTGCAGTAGAATGCTGACAGG + Intergenic
991703368 5:69335553-69335575 CCATGCAGTTGTCAGCTGGCTGG + Intergenic
995395432 5:111681839-111681861 CCGGGCAGTGGAAGGCTGACCGG + Intronic
996310979 5:122104973-122104995 GCTTGCAGAGGAAAGATTGCAGG - Intergenic
998142882 5:139709836-139709858 TCTGGCTGTGGGAAGCTGGCGGG + Intergenic
1002565794 5:180112551-180112573 CCTTGGAGTTGGAAGCTGGGTGG + Intronic
1007725582 6:43913827-43913849 CCTGGCAGTGGGCAGCTGGAGGG + Intergenic
1008312395 6:49991842-49991864 CTTTGCAGTGGAAACCTTACAGG + Intergenic
1008667690 6:53732405-53732427 CCTAGCAGTGATAAGCTGGTGGG + Intergenic
1008820775 6:55628600-55628622 CTTTTCAGTGGAAACCTTGCAGG - Intergenic
1010194608 6:73226500-73226522 ACTTGCAGTGGGAAGCTGACAGG - Intronic
1012424989 6:99104130-99104152 ACCTGCAGTGGCAAGCTTGCAGG - Intergenic
1015052665 6:128861751-128861773 CTTTTCAGTGGAAACCTTGCAGG - Intergenic
1020688896 7:11330162-11330184 CCTTGTTGTGGAAGGCTGTCCGG + Intergenic
1021446140 7:20735735-20735757 CCTTGCAGTGGAAAGCTGGCTGG - Intronic
1027986516 7:85298524-85298546 CCTTGCTGGGGAAGGGTGGCTGG - Intergenic
1029606033 7:101599883-101599905 CCTTGGAGTGGAAAGATGACAGG + Intergenic
1030243684 7:107359035-107359057 GGCTGCAGTGGAGAGCTGGCAGG + Intronic
1030488480 7:110202417-110202439 CTTTGCAGTGGAAATCTTACAGG - Intergenic
1030715439 7:112802604-112802626 CCTGTCAGTGGACAGCTGGATGG + Intergenic
1031638924 7:124138604-124138626 CTTTTCAGTGGAAAGCTTACAGG - Intergenic
1032515488 7:132503468-132503490 ACTTGGAGTGGGCAGCTGGCTGG - Intronic
1033494966 7:141884879-141884901 CCTTGCTCTAGAAAGTTGGCAGG - Intergenic
1033807031 7:144966004-144966026 CCATGCAGTGGAAAGAAGGCTGG + Intergenic
1033819856 7:145122262-145122284 CTTTTCAGTGGAAACCTCGCAGG - Intergenic
1034092937 7:148381038-148381060 CCTTGCAGGGGTAAGCACGCGGG + Intronic
1034111622 7:148542938-148542960 CCCTGAAGAGGAAAGTTGGCTGG - Intergenic
1034901311 7:154909662-154909684 CCCTGCTGTGGAAGGCTGTCTGG - Intergenic
1035139279 7:156740550-156740572 CTTTTCAGTGGAAACCTTGCAGG + Intronic
1036183413 8:6604182-6604204 CCTTCCAGTGCAAACCTGGAAGG - Intronic
1037905439 8:22713578-22713600 CCATGGACTTGAAAGCTGGCAGG + Intronic
1040742924 8:50602840-50602862 CTTTTCAGTGGAAACCTGACAGG - Intronic
1042535026 8:69850293-69850315 CCTTACAGTGGAATGCAGGCTGG - Intergenic
1046449119 8:114364567-114364589 CTTTTCAGTGGAAAGCTTGCAGG + Intergenic
1046811381 8:118537114-118537136 CTTTTCAGTGGAAAGCTTACAGG - Intronic
1047841340 8:128756465-128756487 GCTTTCAGTGGAAACCTTGCAGG + Intergenic
1047910314 8:129520504-129520526 TTTTTCAGTGGAAATCTGGCAGG + Intergenic
1050310536 9:4348398-4348420 CCATGCAGTGGGAAGCTGATAGG + Intergenic
1052909114 9:33864247-33864269 CCTTGTGGTGGAAAGCAGACAGG + Intronic
1056844172 9:90023345-90023367 CCATTCAGTGGAAAGCTGAGTGG + Intergenic
1056957553 9:91094539-91094561 CTTTTCAGTGGAAAGCTTACAGG + Intergenic
1059685669 9:116633386-116633408 CCTGGAAGGGGAAACCTGGCTGG + Intronic
1060158089 9:121334239-121334261 CCCTGCAGTAGAAAGCGGGCAGG + Intergenic
1060793739 9:126501671-126501693 CCTTAAAGTGGAAAACTGGTGGG - Intronic
1062080282 9:134620083-134620105 CCTCCCAGTGGCCAGCTGGCCGG - Intergenic
1186121371 X:6365746-6365768 CTCTCAAGTGGAAAGCTGGCTGG + Intergenic
1187100533 X:16186714-16186736 ATTTGCAGTTGAAAGTTGGCTGG + Intergenic
1187315117 X:18185777-18185799 CTTTTCAGTGGAAATCTTGCAGG + Intronic
1189188224 X:39072394-39072416 CCTTGCAGAGGAAAGAGGTCTGG + Intergenic
1189515435 X:41709328-41709350 CTTTACAGTGGAGAGTTGGCAGG + Intronic
1189854207 X:45207566-45207588 CTTTTCAGTGGAAACCTTGCAGG - Intergenic
1189964816 X:46361742-46361764 CCTTCCAGTGGAAACCTTACAGG - Intergenic
1192887736 X:75354204-75354226 CCTTTCAGTGGAAACCTTACAGG - Intergenic
1194265749 X:91751835-91751857 CCTTGTTGTGGAAGGCTGCCTGG - Intergenic
1197677836 X:129349107-129349129 CTTTTCAGTGGAAAGCTTACAGG + Intergenic
1199368170 X:147013247-147013269 CTTTTCAGTGGAAAGCTTACAGG - Intergenic
1199929113 X:152500469-152500491 CCTTGCTGTGAAAAGCTGGCAGG + Intergenic
1200370736 X:155721607-155721629 CTTTTCAGTGGAAAGCTTACAGG + Intergenic