ID: 1021446469

View in Genome Browser
Species Human (GRCh38)
Location 7:20739057-20739079
Sequence CAGATGCGCAGCCCCCGATT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 39}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021446469_1021446474 28 Left 1021446469 7:20739057-20739079 CCAAATCGGGGGCTGCGCATCTG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1021446474 7:20739108-20739130 TAGACAGCCGCAGTCAAGAAGGG 0: 1
1: 0
2: 0
3: 9
4: 89
1021446469_1021446473 27 Left 1021446469 7:20739057-20739079 CCAAATCGGGGGCTGCGCATCTG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1021446473 7:20739107-20739129 ATAGACAGCCGCAGTCAAGAAGG 0: 1
1: 0
2: 0
3: 4
4: 85
1021446469_1021446470 -10 Left 1021446469 7:20739057-20739079 CCAAATCGGGGGCTGCGCATCTG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1021446470 7:20739070-20739092 TGCGCATCTGTTTGCCTTGTTGG 0: 1
1: 0
2: 1
3: 12
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021446469 Original CRISPR CAGATGCGCAGCCCCCGATT TGG (reversed) Exonic
912776541 1:112509288-112509310 AAGCTGCGCAGCTCCCGCTTCGG + Exonic
920575080 1:207053375-207053397 CAGCTGCGCAGCCCCGGGTAGGG + Intronic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
923086430 1:230706459-230706481 CAGATGCAAAACCCCCGGTTTGG - Intronic
1063125917 10:3136683-3136705 CAGATGGGCACTCGCCGATTAGG - Exonic
1067338611 10:45383276-45383298 CAGATGTGCAGACCCCAGTTAGG + Intronic
1087042574 11:93816118-93816140 CAGATGAGCAGACCCCAGTTTGG + Intergenic
1088815631 11:113418905-113418927 CAGATGCTCAGCCCGCCATGTGG - Intronic
1094587902 12:31794740-31794762 CAGATGAGCAGCCACTGTTTGGG - Intergenic
1095976067 12:47941961-47941983 CAGAGGCCCAGCCCCCGCTCGGG + Intronic
1104511448 12:129383117-129383139 CAGATGGGCAGCTCCTGATTTGG - Intronic
1104677914 12:130727609-130727631 CAGTTGAGCAGCCCCCAATGAGG + Intergenic
1115354815 14:32436096-32436118 CAGATGGGCAGGCCCAGACTGGG + Intronic
1127631839 15:60834717-60834739 CAAATGCGCAGCCCCTCATCGGG - Intronic
1128823181 15:70681034-70681056 CAGGTGCCCAGCCCCTGATGAGG - Intronic
1132629476 16:910266-910288 CAGATGAGCAGCCCCTGGCTGGG + Intronic
1139362664 16:66410671-66410693 CAGATGCGGAATCCCAGATTTGG - Intergenic
1142405815 16:89889025-89889047 CAGTTGGGCAGCCCCAGATGAGG + Intronic
1143815132 17:9506763-9506785 CAGTTGCACTGCCCCAGATTAGG + Intronic
1152158365 17:78650121-78650143 CAGATGCGCAGGCCCTGCCTTGG + Intergenic
1160047538 18:75400736-75400758 GAGAAGAGCAGCCCCCGATAGGG - Intergenic
1166509124 19:43392427-43392449 CACTTGCGCAACCCCGGATTTGG + Intergenic
927523972 2:23720805-23720827 CAGTTGCACTGCCCCAGATTAGG + Intergenic
936370517 2:111898718-111898740 CAGATCCGCAGCCCCGGGATGGG + Exonic
944361844 2:198866514-198866536 CAGATGCTCATCCCCAGGTTTGG + Intergenic
1172539362 20:35699194-35699216 CGCAGGCGCAGCCCCCGAGTGGG + Exonic
1177807534 21:25888967-25888989 CAGATTCGCAGCCTCCTATTTGG + Intronic
954493424 3:50930339-50930361 CAGATCCACAGCCCCCGCCTTGG + Intronic
961394476 3:126577645-126577667 AAGATGGGCAGCCCCCCACTAGG + Intronic
979145255 4:117239461-117239483 CAGATCCGCAGCCTCCATTTGGG - Intergenic
984706553 4:182851315-182851337 CAGATGAGCAGACCCCACTTGGG - Intergenic
989732383 5:44664356-44664378 CAGCTGCGCAGCCACCGCTCGGG + Intergenic
995752193 5:115464137-115464159 CAGATGCACTGGCCCTGATTAGG + Intergenic
995859639 5:116627970-116627992 CAGGTGCCCAGCCCCAGATGTGG - Intergenic
996764545 5:127022751-127022773 AAGATGAGCAACCCCAGATTAGG - Intronic
1001132095 5:169072784-169072806 CAGATGCTCAGACCAGGATTTGG - Intronic
1011136166 6:84103408-84103430 CAGGTGCTCACCCCCTGATTTGG - Intergenic
1019569599 7:1704740-1704762 CAGGTGCCCAGCCCCCCAGTAGG + Intronic
1021446469 7:20739057-20739079 CAGATGCGCAGCCCCCGATTTGG - Exonic
1024891090 7:54204394-54204416 CAGATGGACAGCCCCCAAATTGG - Intergenic
1027402414 7:77822480-77822502 CAGCTGCGCTGCCCCAGATTAGG - Intronic
1187865487 X:23719656-23719678 CACATGCGCAGCTCACGATAGGG + Intronic
1190131642 X:47753768-47753790 CAGAAGCTCAGCTCCCTATTGGG + Intergenic