ID: 1021447946

View in Genome Browser
Species Human (GRCh38)
Location 7:20753357-20753379
Sequence TAGAAATACAACACACAAGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 376}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021447943_1021447946 30 Left 1021447943 7:20753304-20753326 CCATGCTAATTTAAATAACCAAG 0: 1
1: 0
2: 0
3: 22
4: 251
Right 1021447946 7:20753357-20753379 TAGAAATACAACACACAAGTTGG 0: 1
1: 0
2: 0
3: 16
4: 376
1021447944_1021447946 12 Left 1021447944 7:20753322-20753344 CCAAGACTTGCTTTCTTAATTGC 0: 1
1: 0
2: 1
3: 24
4: 261
Right 1021447946 7:20753357-20753379 TAGAAATACAACACACAAGTTGG 0: 1
1: 0
2: 0
3: 16
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021447946 Original CRISPR TAGAAATACAACACACAAGT TGG Exonic
900110318 1:1002564-1002586 TAAAAATACAAAACACTAGCCGG - Intergenic
900133250 1:1099934-1099956 TAAATATAAAAAACACAAGTAGG - Intronic
900508902 1:3048489-3048511 TTGAAAAACAAGACAAAAGTTGG + Intergenic
901033984 1:6325234-6325256 TAAAAATACAAAAAATAAGTGGG + Intronic
901348896 1:8574100-8574122 TGGAAATACAACACATTGGTTGG - Intronic
902262002 1:15233054-15233076 GAAACATACAACACAAAAGTAGG - Intergenic
903008764 1:20315859-20315881 TACAAAGACAACACACAGGCTGG - Intronic
903597328 1:24504723-24504745 TAGAAAAAAAACACAGAAGGTGG + Intronic
905197576 1:36292430-36292452 TAAAAATACAAAAAACTAGTGGG - Intronic
905438421 1:37975992-37976014 TAAAAATACAAAAAACTAGTCGG + Intronic
906368567 1:45232856-45232878 TAAAAATACAAAAAACTAGTCGG - Intronic
906624797 1:47316111-47316133 TACAAATAAGACACACATGTTGG + Intergenic
906971045 1:50513919-50513941 GAGAAATACAATAAGCAAGTAGG - Intronic
908410669 1:63861445-63861467 TAGAGACACAACACTCAAGCAGG - Intronic
909063161 1:70902604-70902626 TAGAAATACTTCACAGAAGAGGG + Intronic
909312124 1:74165100-74165122 TAGAAAAACAAGAAAAAAGTGGG - Intronic
909573386 1:77143738-77143760 TAGAAATACTATACAGAATTTGG - Intronic
910562363 1:88604289-88604311 TAAAAATACAAAAAACTAGTGGG + Intergenic
911116402 1:94250263-94250285 TAAAAATACAACAGACATGATGG - Intronic
911190996 1:94948307-94948329 TAAAAATACAAAAAATAAGTCGG - Intergenic
912533539 1:110344361-110344383 AAGAAATAAAACACACATTTTGG - Intronic
912760818 1:112365737-112365759 TAAAAATACAAAACATTAGTTGG + Intergenic
914264000 1:146021951-146021973 GAGAAATATGACAGACAAGTTGG + Intergenic
917602953 1:176595620-176595642 TAGAAATGCATCCTACAAGTAGG - Intronic
917699942 1:177570111-177570133 TAGATAGACAACAATCAAGTAGG - Intergenic
917992907 1:180401621-180401643 TAGAAATACAAAAAATTAGTGGG + Intronic
918892136 1:190287945-190287967 GAGAAATACAACACAAATGCAGG + Intronic
920649902 1:207829357-207829379 TAGAAATAAGACAAACAAATAGG + Intergenic
921718348 1:218442608-218442630 AAGAAACACAAAGCACAAGTAGG - Exonic
922120479 1:222662410-222662432 TACAGATAGAACACACAAATAGG - Intronic
923348312 1:233079361-233079383 TAAAAATACAAAACATTAGTAGG + Intronic
923683872 1:236141278-236141300 TGGAAAAAGAACACACAATTAGG + Intergenic
923754383 1:236777360-236777382 CCAAAATACAACACACATGTCGG + Intergenic
1062909424 10:1203218-1203240 TTGAAATACCACAGATAAGTGGG + Intronic
1063983813 10:11479735-11479757 TAAAAATACAACAAATTAGTCGG - Intronic
1065840946 10:29700630-29700652 TAAAAATACAAAAAACTAGTCGG - Intronic
1066571500 10:36777712-36777734 TAAAAATACAAAATACAATTAGG - Intergenic
1066660370 10:37733461-37733483 TAGAAATTAAAAACAAAAGTAGG + Intergenic
1067384140 10:45803569-45803591 TAGAAATACAACCAACCGGTCGG + Intergenic
1067880055 10:50035240-50035262 TAGAAATACAACCAACCGGTCGG - Intergenic
1067891828 10:50144139-50144161 TAGAAATACAACCAACTGGTCGG + Intergenic
1068020042 10:51569883-51569905 TAGAAATACACCATACTAGCTGG - Intronic
1068612019 10:59070523-59070545 TTCAAATACAACAAAAAAGTTGG - Intergenic
1068630793 10:59295346-59295368 TAGAAATTCAAAGCACAAGAAGG + Intronic
1069115533 10:64501328-64501350 TAGAATTTTAACACACAAATAGG - Intergenic
1069966057 10:72118203-72118225 TAAAAATACAAAAAACTAGTCGG + Intronic
1070031892 10:72685077-72685099 TAAAAATACAAAAAATAAGTGGG - Intergenic
1071686601 10:87764511-87764533 TAGAAAAACAAAACCAAAGTTGG + Intronic
1071730752 10:88246015-88246037 TAGAATTGCAACCCACATGTGGG + Intergenic
1072329158 10:94329485-94329507 TAAAAATACACCACACAGGCTGG + Exonic
1072497027 10:95972012-95972034 TAAAAATACAACACAGAAAAAGG - Intronic
1072956229 10:99890642-99890664 GAAAAATAAAACACACAATTGGG - Intronic
1072993406 10:100220909-100220931 TAGAAATGCAACAAGCAATTGGG + Intronic
1073308926 10:102525662-102525684 TAAAAATACAAGAAACTAGTTGG - Intronic
1074367193 10:112868574-112868596 TAAAAATACAAAACATTAGTCGG - Intergenic
1075276718 10:121100469-121100491 TAGAAAGACAGCTCAGAAGTTGG + Intergenic
1076148139 10:128141483-128141505 GAGAAATAAATCACTCAAGTAGG + Intergenic
1081226684 11:40532680-40532702 AAGAAAAACAACATAGAAGTGGG + Intronic
1081304018 11:41489317-41489339 TTGGAATACAATATACAAGTGGG + Intergenic
1081943052 11:46961515-46961537 TAAAAAGACAACCCACAAGATGG - Intronic
1083569090 11:63746674-63746696 TAAAAATACAAAACACTAGCTGG - Intronic
1085078398 11:73612497-73612519 TAAAAATACAAAAAACTAGTCGG + Intergenic
1085552591 11:77388513-77388535 TAGAAATACAAAAAATAAGCCGG - Intronic
1086068715 11:82775266-82775288 TAGAAAGACAACCCACGAATGGG + Intergenic
1086475859 11:87172436-87172458 TCGTAATACAAAACAAAAGTAGG - Intronic
1086563956 11:88202982-88203004 TTAAAAAACAACACACAAGTGGG + Intergenic
1087561219 11:99793219-99793241 TAAAAATACAAAACATTAGTTGG - Intronic
1087604007 11:100352611-100352633 TAAAAATACAAAACATAAGATGG + Intronic
1088202022 11:107347662-107347684 TAGAAATACACCACATATTTTGG + Intronic
1088274905 11:108074821-108074843 TAAAAATAAAACAAATAAGTAGG + Intronic
1090139510 11:124240050-124240072 TACAATCACAACACACACGTGGG - Intergenic
1090548831 11:127796156-127796178 TACAAACAAACCACACAAGTTGG + Intergenic
1090814519 11:130280663-130280685 TGGAATTACAACACAAAAATTGG + Intronic
1093731344 12:22568943-22568965 TAAAAATACAAAACATTAGTGGG - Intergenic
1095090286 12:38098290-38098312 TAGAAATACAAAAAACTAGCTGG + Intergenic
1095177933 12:39114557-39114579 GACTAATACAACACACAACTTGG + Intergenic
1095394915 12:41750775-41750797 TAGAAAGGCAACCCACAGGTTGG - Intergenic
1097067554 12:56332189-56332211 TAAAAATAGAAAACACAGGTGGG + Intronic
1097475342 12:60048120-60048142 TAGATATAAAGCACAAAAGTTGG - Intergenic
1097706729 12:62876550-62876572 TAGGAAAAGAAAACACAAGTGGG + Intronic
1097885827 12:64728083-64728105 TAAAAATACAAAAAACAAGCTGG - Intronic
1099611403 12:84876944-84876966 TAGAACAACAACAAAAAAGTAGG - Intronic
1099962915 12:89413837-89413859 CAGAAATGCAACACAAAATTGGG - Intergenic
1100326137 12:93541672-93541694 GAGAAATAGGAGACACAAGTGGG - Intergenic
1100803126 12:98253827-98253849 TGGAAAGACAACAGAGAAGTAGG + Intergenic
1101174065 12:102130691-102130713 TAGAAATACAAAACATTAGCCGG + Intronic
1104357986 12:128105425-128105447 TATAAATATATAACACAAGTAGG - Intergenic
1105292860 13:19063589-19063611 TAAAAATACAAAAAACAAATTGG + Intergenic
1106834782 13:33622475-33622497 TAAAAATACAAAAAACTAGTCGG + Intergenic
1107026542 13:35807775-35807797 GAAAAATAAAACAGACAAGTAGG + Intronic
1108575983 13:51791495-51791517 TATACATACACCACACAAATAGG + Intronic
1109007473 13:56897345-56897367 AGGAAATAAAAAACACAAGTTGG + Intergenic
1109883197 13:68508720-68508742 GAGAAATAAAACACACTAGTTGG + Intergenic
1109939396 13:69341183-69341205 TAGAAATACAACACATCAAAAGG - Intergenic
1111332329 13:86775985-86776007 TAGAAATACAATAGACACTTAGG + Intergenic
1111757863 13:92421535-92421557 TAGAAATACAAAAAATTAGTCGG + Intronic
1111797269 13:92938481-92938503 TAAAAATATAACTCACAAATAGG - Intergenic
1113400524 13:109988484-109988506 TATAGACACAACACATAAGTGGG - Intergenic
1113484857 13:110646322-110646344 TTAAAATACAAGACACACGTGGG + Intronic
1113714279 13:112492327-112492349 AAGAAATAAAAGACAAAAGTTGG - Intronic
1114641867 14:24228871-24228893 AAGAAATGCAACAAACAAGAGGG + Intronic
1114949592 14:27732212-27732234 TAAAAATACAAAATACCAGTTGG - Intergenic
1115104417 14:29743648-29743670 TAGAAATACGCCTCACAAGAAGG + Intronic
1115227530 14:31119475-31119497 CACAAATACAAAACACATGTTGG + Intronic
1115578908 14:34738926-34738948 TAGGAATACAACTTACAAGGGGG - Intergenic
1116333726 14:43630178-43630200 TAGAAATACAGCAAAGTAGTGGG - Intergenic
1116520306 14:45838763-45838785 TAGAAATACAACAAATGACTAGG - Intergenic
1117591813 14:57277736-57277758 TAGAAATTGAAAACAAAAGTAGG + Intronic
1118294103 14:64553113-64553135 TAAAAATACAAAAAACAAGCTGG - Intronic
1119052073 14:71379138-71379160 TAGAAAAGCAACACATAACTGGG - Intronic
1120592766 14:86395120-86395142 TAAAAATACAAAACATTAGTCGG + Intergenic
1120620674 14:86760527-86760549 AAGAAATAAAACACACAGATTGG - Intergenic
1121618942 14:95332738-95332760 GAGAAAGACAACAAACAACTCGG + Intergenic
1122538692 14:102484362-102484384 TAGACAGAAAACACACAACTTGG - Intronic
1124627219 15:31315107-31315129 TAAAAATACAAAAAAAAAGTAGG + Intergenic
1125251312 15:37708030-37708052 TAGAACTTCAACATACAAATGGG - Intergenic
1125670526 15:41469125-41469147 TAAAAATACAAAACAAAATTAGG - Intronic
1126231442 15:46331049-46331071 GAGGAATACAACACAAGAGTGGG - Intergenic
1126464387 15:48948118-48948140 TAGAAATAAAAAACACAGCTAGG - Intronic
1126826302 15:52552767-52552789 TATAAATAAAACACATAATTTGG + Intronic
1126947377 15:53836900-53836922 CAGAAATACAGAACACAAGGCGG - Intergenic
1127083124 15:55399931-55399953 TAAAAATACAACAAATTAGTAGG + Intronic
1129578378 15:76778865-76778887 TCTAAATACAAAACACAGGTAGG + Intronic
1129614247 15:77085189-77085211 TGGAAATATGACACAGAAGTTGG - Intergenic
1131492515 15:92875220-92875242 TAAAAATACAAAAAACTAGTTGG + Intergenic
1134004216 16:10807031-10807053 TAGAAATATGACACATAAGCAGG - Intronic
1136144234 16:28306505-28306527 GAGCAATGCAACAGACAAGTGGG + Intronic
1137982745 16:53083738-53083760 TAAAAATAAAACAAAGAAGTCGG - Intronic
1140021036 16:71239149-71239171 CACAAATACAGCACACAAATAGG - Intergenic
1140705210 16:77622376-77622398 AAGAAATAAAACCCATAAGTTGG + Intergenic
1141571476 16:84936557-84936579 TAGAAATACAACAGTCAGCTGGG + Intergenic
1142645242 17:1307424-1307446 TAAAAATACAAAACATTAGTGGG + Intergenic
1143616593 17:8054885-8054907 TAAAAAAAAAACACACAAGGGGG - Intergenic
1144540582 17:16137384-16137406 TAGTAATACAAAACACAATCAGG + Exonic
1145113456 17:20186132-20186154 AAAAAATACAAAACACAAGCTGG - Intronic
1147192315 17:38745168-38745190 TAAAAATACAAAACATTAGTTGG + Intronic
1147251893 17:39157627-39157649 TAGAAATACAAAAATCAACTGGG + Intronic
1148273858 17:46285400-46285422 TAAAAATACAAAAAACTAGTCGG - Intronic
1148373921 17:47125077-47125099 TAAAAATACAAAACAAAATTAGG - Intronic
1149630155 17:58115728-58115750 CAGAAATAAAGCACAAAAGTAGG - Intergenic
1149976506 17:61271287-61271309 TAAAAATACAAAAAACTAGTCGG - Intronic
1150351634 17:64449637-64449659 TAGAAAGCCAACACACAGGCTGG + Intronic
1150724878 17:67643567-67643589 TAGACACAGAGCACACAAGTTGG - Intronic
1150810111 17:68349585-68349607 TAAAAATACAACAAACAGGCTGG + Intronic
1155794404 18:30016978-30017000 ACCAAATAAAACACACAAGTGGG - Intergenic
1156721354 18:40073717-40073739 TAAAAATACAACAATCAACTAGG + Intergenic
1156736452 18:40265653-40265675 TGGAAAAATAACAGACAAGTTGG + Intergenic
1156856062 18:41782517-41782539 TAAAAATACAAAAAACAACTGGG + Intergenic
1157604847 18:48919629-48919651 TACAAATTCAAGACACAAGAAGG + Intergenic
1158650865 18:59284225-59284247 TAAAAATACAAAAAACTAGTAGG - Intronic
1159395838 18:67854968-67854990 TAAAAATACAAAACATTAGTGGG - Intergenic
1159427586 18:68309858-68309880 TAAAAATACAAAAAATAAGTCGG - Intergenic
1160203361 18:76813346-76813368 TAAAAATACAACAAATAAGCTGG - Intronic
1161525256 19:4750775-4750797 TAGAAATACAAAAAATTAGTTGG - Intergenic
1163022183 19:14488288-14488310 TAAAAATACAATACACAGGTGGG + Intronic
1163505134 19:17701216-17701238 TAAAAATACAAAAAACTAGTGGG - Intergenic
1166013605 19:39962518-39962540 TAAAAATACAAAACACTAGCCGG + Intergenic
1166646660 19:44537199-44537221 TAAAAATACAAAACATTAGTCGG - Intergenic
1167002535 19:46754560-46754582 AAGAAAAACAAAACAAAAGTGGG - Intronic
1167877736 19:52428240-52428262 TAAAAATACAACAAATTAGTCGG + Intergenic
1168548667 19:57275161-57275183 TAAAAATACAAAACATTAGTGGG + Intergenic
927755795 2:25706913-25706935 TAAAAATACAAAACATTAGTCGG - Intergenic
928047473 2:27951125-27951147 CAGAAATACAACAGAGAAGATGG - Intronic
928611135 2:32993603-32993625 TAGAAATGTAACCCACAGGTTGG + Intronic
928970821 2:37026957-37026979 TAAAAATACAACAAATTAGTGGG - Intronic
929190771 2:39137519-39137541 TAAAAATACAACAAATAAGCTGG - Intergenic
930492850 2:52097910-52097932 TTGAAATAAAAAAAACAAGTTGG - Intergenic
932859133 2:75270408-75270430 TAAAGAAACAACACACAAGATGG - Intergenic
933032684 2:77351329-77351351 ATGAAATACAACACTTAAGTTGG - Intronic
934083270 2:88487705-88487727 TAAAAATACAAGACACCAGCTGG - Intergenic
934100436 2:88648203-88648225 TATAATTACAACACAAAAGGTGG + Intergenic
935117486 2:100148946-100148968 TAGAAAGACATCATGCAAGTGGG + Intergenic
935251193 2:101262894-101262916 TAGACATGCAACAAACAACTTGG - Intronic
936527765 2:113253357-113253379 TAGAAATTGAAAACAAAAGTTGG - Intronic
938914824 2:135926923-135926945 TAGAAAGACAACCCAGCAGTAGG - Intronic
939181714 2:138810767-138810789 TAGAAATAGAAAACAGAAATAGG - Intergenic
940491027 2:154360986-154361008 TGAAAATACAAAACACAATTTGG + Intronic
940614633 2:156034947-156034969 GAGAAATATAATACATAAGTAGG - Intergenic
941121060 2:161530759-161530781 TACAAATACAATACAGAAGAAGG - Intronic
942797533 2:179839624-179839646 AGGAAATACAACATTCAAGTTGG + Intronic
942974351 2:181997065-181997087 TAGAAATACAAAACATTAGCTGG + Intronic
943088657 2:183347954-183347976 TAAGAATACTACACACTAGTTGG - Intergenic
943872531 2:193019283-193019305 TGGAAAGACAACACACAAAGTGG - Intergenic
944044233 2:195390176-195390198 TAGAAAAATAAGCCACAAGTTGG + Intergenic
945094511 2:206206199-206206221 TTTACATACAACAAACAAGTTGG - Intronic
945204014 2:207312460-207312482 TCGAATTACAATACACAAGCAGG + Intergenic
945315995 2:208371132-208371154 TTGAAATACAATCCCCAAGTTGG - Intronic
945823435 2:214692195-214692217 TAGAAATACAACTCACAGCATGG + Intergenic
946582386 2:221143820-221143842 AACAAATATAACACACATGTTGG - Intergenic
946663233 2:222023014-222023036 TAAAAATACAACAAATTAGTGGG + Intergenic
947076302 2:226349502-226349524 AACTAATACAAAACACAAGTCGG - Intergenic
947679901 2:232021094-232021116 TAGAAAAACACCACACAACTGGG - Intronic
1170873181 20:20226971-20226993 TAGAAATTTAAAACAAAAGTGGG - Intronic
1172240030 20:33406985-33407007 TAAAAATACAAAACATTAGTGGG + Intergenic
1172761387 20:37325672-37325694 AAAAAATACAAAACACTAGTTGG - Intergenic
1172866035 20:38098242-38098264 TAAAAAGACAACACACAGGGTGG - Intronic
1173889889 20:46498700-46498722 TAGGAATTCAACACACATTTTGG - Intergenic
1174994596 20:55551701-55551723 TAAAAATACAAAAAACTAGTTGG - Intergenic
1175863817 20:62163985-62164007 TAAAAATACAAAACATAAGTTGG + Intronic
1176142641 20:63551908-63551930 TAAAAATACAAAACACTAGCTGG - Intronic
1181598425 22:23934050-23934072 TAGAATTGTAACATACAAGTGGG - Intergenic
1181813436 22:25419822-25419844 TACAAATACAAGAGACAATTAGG - Intergenic
1182170825 22:28227444-28227466 TAAAAAGACAACACACAAAATGG + Intronic
1183040146 22:35171881-35171903 TAAAAATACAAAACACTAGCAGG + Intergenic
949501406 3:4683565-4683587 TGGACAGACAACACACACGTGGG - Intronic
949721429 3:6994853-6994875 TAGAAATACAAAACCCAATTTGG - Intronic
949782533 3:7706158-7706180 TAGACATAGAAAAAACAAGTAGG + Intronic
950344760 3:12283040-12283062 TAGACATAAAAATCACAAGTGGG + Intergenic
950938610 3:16869694-16869716 GAGAAAGACAAAACACAATTTGG + Intronic
951383885 3:22021358-22021380 TAGAAATCCACAACACAAATAGG + Intronic
952012453 3:28916017-28916039 TAGAAATACAACAGATAAGCTGG - Intergenic
952085584 3:29816433-29816455 GAGAAACACAACACAGATGTTGG + Intronic
953725341 3:45393150-45393172 TTGAAATACAACTCATAGGTTGG - Intronic
954171649 3:48808413-48808435 TAAAAATACAACACATTAGCTGG - Intronic
955168473 3:56539341-56539363 AAGAAAAACAACACACTAGATGG + Intergenic
955347907 3:58174277-58174299 TGGAAAGAAAACACAAAAGTCGG - Intergenic
958522605 3:95210544-95210566 TTGAAATAAAACATACAATTGGG + Intergenic
958959608 3:100496352-100496374 TAGAAAAACAGGACACAAATAGG - Intronic
959784885 3:110284165-110284187 AATAGATACAACACAAAAGTAGG - Intergenic
960196513 3:114775297-114775319 TAAAAACACAAAAAACAAGTGGG - Intronic
960331690 3:116367667-116367689 TAAAAATACAAAAAACTAGTTGG - Intronic
960847795 3:122021072-122021094 TAAAAATACAAGACTCAAATTGG + Intronic
961943861 3:130665323-130665345 TTGAAATAAAACACCCAAATGGG + Intronic
962416547 3:135187889-135187911 TAAAAAGACAAAACAGAAGTAGG - Intronic
962724157 3:138205568-138205590 AAGGAATACAAGACAAAAGTAGG - Intronic
963214658 3:142731678-142731700 TAAAAATTCAAAACACAAGCCGG - Intronic
963411012 3:144927759-144927781 TAGCAATATATCACTCAAGTTGG - Intergenic
964087920 3:152839605-152839627 AAGAAATACAGCATGCAAGTTGG + Intergenic
965351104 3:167612292-167612314 TAGAAAAACTACACACATATGGG + Intronic
965366499 3:167807026-167807048 TAGAATTTAAACACATAAGTAGG - Intronic
965530651 3:169767303-169767325 TAGAAATACAACAGAAATATTGG + Exonic
965785221 3:172328117-172328139 TAAAAATAAAACACTCTAGTGGG - Intronic
966215836 3:177501040-177501062 TAAAAATACAAAAAACTAGTCGG + Intergenic
967938639 3:194749102-194749124 TAAAAATACAAAAAACTAGTTGG - Intergenic
968119184 3:196112495-196112517 TAGAAATACAAAAAATTAGTTGG - Intergenic
968207289 3:196814881-196814903 TAGAAATACACCACTCAGGCTGG + Intronic
968656687 4:1781420-1781442 TAAAAATACAAAACATAAGCCGG + Intergenic
970035576 4:11731328-11731350 TTGAAATGCCACACACAAATAGG - Intergenic
971824717 4:31606210-31606232 TAAAAAGACAACACTCTAGTTGG + Intergenic
973281732 4:48365306-48365328 TAAAAATACAAAAAACTAGTTGG + Intronic
973768304 4:54183737-54183759 TAAAAATACTAAACACAAATTGG + Intronic
974167096 4:58217448-58217470 TATATATACAACGCACAATTAGG - Intergenic
974608555 4:64184833-64184855 TAGAAATACAAAAAATTAGTTGG + Intergenic
975455691 4:74587313-74587335 TAAAAATACAAAACATAATTGGG - Intergenic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
976048471 4:80982002-80982024 TACAAATATAACAAACAATTTGG - Intergenic
976247912 4:83022073-83022095 TAGAAATACTACACACAGCCGGG + Intergenic
976578102 4:86699636-86699658 TGGAAAAACATCAAACAAGTGGG - Intronic
977128079 4:93195728-93195750 TAGAAATGGAACACACAACTGGG - Intronic
977252356 4:94703442-94703464 AAAAAATACAACACAGAAGGGGG + Intergenic
977481677 4:97585711-97585733 TAGAAACAGAAGGCACAAGTAGG + Intronic
978481159 4:109192422-109192444 TAGAACTTCAACATACGAGTTGG - Intronic
978504185 4:109438800-109438822 TAGAAATACAACACCAAGGAAGG - Intronic
978967917 4:114764852-114764874 TAGAAATACAACAGAAAAAAAGG - Intergenic
979104713 4:116668971-116668993 TGAAAATACAAGACACAGGTTGG + Intergenic
979581602 4:122367029-122367051 TCTGAATACAACACACCAGTGGG - Intergenic
979893159 4:126125971-126125993 CAGAAATATAACACACTATTGGG + Intergenic
979894524 4:126143274-126143296 TAGAAATTAAATACACAACTAGG + Intergenic
979932336 4:126646704-126646726 TAAAAATACAAAAAATAAGTCGG - Intergenic
979992834 4:127395504-127395526 TAAAAATACAAAAAATAAGTTGG + Intergenic
981097937 4:140800730-140800752 GACAAAGAAAACACACAAGTTGG + Intergenic
981473758 4:145166677-145166699 TAAAAATACAAAACATTAGTCGG + Intronic
981812291 4:148789527-148789549 TTAAAATTCAACATACAAGTAGG + Intergenic
981825652 4:148938001-148938023 TAGAAAAACAACATATATGTTGG - Intergenic
982313003 4:154004847-154004869 TAAAAATACAAAAAACAAATGGG - Intergenic
982866054 4:160513150-160513172 GAGAAATAAAACACAAAATTTGG - Intergenic
983294983 4:165855750-165855772 TAGAAATACTACACAAATGTAGG - Intergenic
983415818 4:167452936-167452958 TAAAAATTGAACACAAAAGTGGG - Intergenic
983696605 4:170540534-170540556 TAGAAAGTCTACACACAACTTGG - Intergenic
984785575 4:183564598-183564620 AAGAAATAAAACTGACAAGTGGG - Intergenic
984925748 4:184805081-184805103 AAGAAAAACAACAAACAAGTGGG + Intronic
985052203 4:186002178-186002200 TGGAAATACAACAGCCCAGTCGG - Intergenic
985884968 5:2670711-2670733 TAGAAATACAACCCCCACCTAGG + Intergenic
987252762 5:16117478-16117500 GAGAAAAACAGCACACATGTAGG + Intronic
988156586 5:27459662-27459684 TAATAATACAAAACTCAAGTGGG + Intergenic
988401201 5:30762613-30762635 TAGAAATACAAAACATTAGTTGG + Intergenic
988837030 5:35043850-35043872 TAAAAATACAAAACACTAGCCGG - Intronic
988901101 5:35733274-35733296 TAAAAATACAAAAAACTAGTCGG - Intronic
990025994 5:51189925-51189947 TAGAAAATCATCACAGAAGTGGG - Intergenic
992945588 5:81805940-81805962 TAGAAACACAATATACATGTAGG + Intergenic
993425745 5:87762233-87762255 GAGAAGTAAAAGACACAAGTTGG + Intergenic
993688288 5:90967881-90967903 TACAAAAACAACACACACCTAGG + Intronic
993988036 5:94620038-94620060 TAAAAATACAAAACATTAGTCGG - Intronic
994409369 5:99387736-99387758 TAGAACTATAAAACACAAGACGG + Intergenic
994689676 5:103000991-103001013 AAAAAATACACCACACAATTTGG + Intronic
994929375 5:106161998-106162020 TAGATATCTAACAAACAAGTAGG - Intergenic
995585602 5:113644944-113644966 TAAAAATACAACAAATTAGTGGG - Intergenic
996632219 5:125647434-125647456 TAAAAAGACAACACAAGAGTGGG + Intergenic
997341103 5:133145174-133145196 TAAAAATACAACAAACTAGCTGG + Intergenic
997475936 5:134142522-134142544 TAGGAACACTACAGACAAGTGGG - Intronic
1000214501 5:159141773-159141795 TAGGAATACAGCACACTGGTGGG - Intergenic
1000508378 5:162150154-162150176 TATATATAAAACACACAAGGAGG - Intronic
1002678541 5:180940048-180940070 TATAAATACAACATACCAGCTGG + Intronic
1002710856 5:181194209-181194231 TTGAAACACAAAACACAAGTTGG - Exonic
1004253884 6:14045258-14045280 TAGAAATACAAAACATTAGCTGG - Intergenic
1004269018 6:14177289-14177311 TAGAAATACAACTGCCAACTTGG - Intergenic
1004278336 6:14257689-14257711 TAAAAATACAAAAAACTAGTTGG + Intergenic
1004481465 6:16023494-16023516 TAAAAATACAACAAACTAGCTGG - Intergenic
1005116535 6:22344771-22344793 TATAAACACACCATACAAGTTGG - Intergenic
1005420340 6:25641971-25641993 GAGAAATACAACACAGAGCTAGG - Intergenic
1005629414 6:27693656-27693678 TAAAAATACAAAAAACTAGTTGG - Intergenic
1005855342 6:29857447-29857469 AAAAAATAAAACACACAAATTGG + Intergenic
1006032964 6:31191057-31191079 TAAAAATACAAAACATTAGTGGG - Intergenic
1007138720 6:39549572-39549594 TAGAAATACATCACCCAATATGG - Intronic
1008246719 6:49184114-49184136 TAAAAATACAACCCTCAAATTGG + Intergenic
1008977236 6:57441930-57441952 TAGAAATATAAAAAACAACTGGG - Intronic
1009165372 6:60334878-60334900 TAGAAATATAAAAAACAACTGGG - Intergenic
1009280563 6:61745642-61745664 TAGAAGTGAAAAACACAAGTTGG - Intronic
1009546453 6:65026451-65026473 CAGAAATAAAACAAACATGTAGG + Intronic
1010052559 6:71524883-71524905 TTGAAATACAACATCCAGGTAGG + Intergenic
1010652731 6:78474097-78474119 TAGAAATACTACACAGAATTTGG + Intergenic
1010935002 6:81850391-81850413 TAGAATTATAACACACATATAGG - Intergenic
1012476799 6:99622403-99622425 AAGAAATAAAACACAGAATTAGG - Intergenic
1014002218 6:116376959-116376981 TAGAAATAAAACTCAAAAGGTGG - Intronic
1014079843 6:117273154-117273176 CAGAAATACATCACCCAAGGTGG + Exonic
1014634133 6:123824148-123824170 TAGAAATACAACACATAGTCAGG + Intronic
1016348147 6:143138591-143138613 TAGTAATACAATAAAAAAGTAGG + Intronic
1016690458 6:146931759-146931781 TAGAAAAAAATCACACACGTAGG + Intergenic
1018410051 6:163535768-163535790 TAAAAATACAAAAAATAAGTCGG + Intronic
1018899693 6:168044796-168044818 TAGAAAAACAACATGCAAGCTGG - Intronic
1021285600 7:18777530-18777552 TATAAATACAACACGAAACTGGG - Intronic
1021447946 7:20753357-20753379 TAGAAATACAACACACAAGTTGG + Exonic
1022824451 7:33994629-33994651 TAAAAATACCAAACACAAGATGG - Intronic
1022933798 7:35151446-35151468 TAGAAACACTACACAGATGTGGG - Intergenic
1022947179 7:35298614-35298636 TAGAAATATAATATACAATTAGG + Intergenic
1023292510 7:38683101-38683123 AAGAAAAAAAACACCCAAGTTGG - Intergenic
1024642901 7:51345824-51345846 GAGAGAAACAACCCACAAGTAGG + Intergenic
1024845206 7:53634524-53634546 GAGAAAAACAACACACACTTTGG + Intergenic
1026210767 7:68302495-68302517 TAAAAAGACAACCCACAAATTGG - Intergenic
1026249466 7:68656517-68656539 TGAAAAGACAACCCACAAGTGGG + Intergenic
1026501368 7:70946044-70946066 GAGACATACAACAAACAAGTTGG - Intergenic
1028893593 7:96015622-96015644 TGGAAATTCAACAGACAAATGGG - Intronic
1032102517 7:128994446-128994468 TAGAAATACAAAACACAGCAGGG - Intronic
1032597502 7:133256141-133256163 TAAAAATACAAAACATTAGTCGG - Intronic
1035631246 8:1108032-1108054 TAAAAAGAAAACACGCAAGTTGG - Intergenic
1038203267 8:25437384-25437406 TAGAAATACAAAAGACAGGCCGG + Intronic
1039070542 8:33645577-33645599 TATAAATACAACATACAGGCTGG - Intergenic
1042128803 8:65565936-65565958 CAGAAACACAACAAACAATTGGG + Intergenic
1042567585 8:70128275-70128297 GAAAAATATAACACACTAGTAGG + Intronic
1043138682 8:76559958-76559980 TAGAAATACAACAAAGAGGCTGG - Intergenic
1044203600 8:89465400-89465422 AACAAATACAACACACTAATTGG + Intergenic
1044302648 8:90604196-90604218 TATAAATACAAAAAATAAGTCGG - Intergenic
1044551467 8:93517272-93517294 TAGAAAGACAAAACTCAATTTGG + Intergenic
1045037378 8:98186186-98186208 TAAAAATACAAGACATAAGCCGG - Intergenic
1045153978 8:99444977-99444999 TAAAAATACAACTAAAAAGTAGG - Intronic
1047116305 8:121845156-121845178 TAAAAATACAAAACATTAGTCGG - Intergenic
1047975050 8:130121620-130121642 TAAAAATACAAAAAACTAGTCGG + Intronic
1048223746 8:132565921-132565943 TAGAAATGCAACAGAAAAGGTGG + Intergenic
1048735221 8:137492121-137492143 TAGAAATTCAAAACACACATCGG + Intergenic
1049390605 8:142368159-142368181 CAGAAAGACAACAGACAAGCAGG + Intronic
1049984698 9:938717-938739 TAGAAATAAAGCACCCAAATTGG - Intronic
1050069330 9:1793807-1793829 TAAAAATACAACAAACTAGCTGG - Intergenic
1050174327 9:2854189-2854211 TAAAAATACAAAACATTAGTCGG - Intergenic
1050427633 9:5527988-5528010 TAAAAATACAAAACAAAAGAAGG - Intronic
1050523964 9:6529604-6529626 TAAAAATACAAAACACTAGCCGG - Intergenic
1050739717 9:8805831-8805853 TAGAAATACAAAAAATAAGCCGG + Intronic
1050747607 9:8894897-8894919 GAGAGAGACAACACACAATTTGG + Intronic
1051646213 9:19271359-19271381 TAAAAATACAAAACATTAGTGGG - Intronic
1051901832 9:22051293-22051315 AAGAAAAACTACACACTAGTTGG - Intergenic
1053115982 9:35503020-35503042 TAAAAATACAAAACATTAGTTGG - Intronic
1054893586 9:70281200-70281222 TAAAAATACAAAAAAAAAGTTGG - Intronic
1055846920 9:80576343-80576365 TAGGAATACACCTAACAAGTAGG + Intergenic
1056317307 9:85402403-85402425 CACAAATAGAAAACACAAGTGGG + Intergenic
1056549190 9:87637252-87637274 TAAAAATACAAAAAACAACTGGG - Intronic
1058199678 9:102023958-102023980 TAGAAATACAGCTAACAAGGAGG - Intergenic
1059865707 9:118511747-118511769 TAGAAACCCAACACACATGGAGG + Intergenic
1061298656 9:129691478-129691500 TAGGAATACCACACACTGGTGGG + Intronic
1186492168 X:9982330-9982352 TAGAAATACAAAAAATAAGCTGG + Intergenic
1186785637 X:12954132-12954154 AAGACAGAGAACACACAAGTGGG + Intergenic
1186789919 X:12987184-12987206 TAGAAATTCTACAAACCAGTTGG - Intergenic
1187117991 X:16373260-16373282 AAGAAATACAAAACACAGCTCGG + Intergenic
1187799383 X:23043480-23043502 TAGAAATACAACAAAAAATAAGG - Intergenic
1188073784 X:25749967-25749989 TGAACATACAGCACACAAGTAGG - Intergenic
1189899092 X:45687347-45687369 TAAAAATACAAAAACCAAGTGGG - Intergenic
1190177158 X:48159745-48159767 TAGAAATACTACAAACAGGTAGG - Intergenic
1190181088 X:48193449-48193471 TAGAAATACTACAAACAGGCTGG + Intronic
1191632996 X:63344021-63344043 TAGATATAAAAGACACAAATAGG + Intergenic
1193309895 X:79993927-79993949 TAGAAATAAAAGGCACAAATTGG + Intergenic
1193314531 X:80048490-80048512 TAGAAATATACCAAACAAGGAGG - Intergenic
1193512536 X:82422000-82422022 AACAAAAACAACACACAAGTGGG + Intergenic
1194096933 X:89652505-89652527 TAGAAAAACATCAAACAAATTGG - Intergenic
1194433825 X:93845195-93845217 TAAAAATAAAAGACACAAATTGG - Intergenic
1194452355 X:94060314-94060336 AAGAGATCCAACACACAAGAAGG + Intergenic
1194682135 X:96867378-96867400 TAAAAATACAAAAAATAAGTTGG - Intronic
1195409260 X:104551169-104551191 TAGAATTGGAACACACAGGTAGG + Intergenic
1195811855 X:108842495-108842517 TAAAAAGACAACATACAAATTGG - Intergenic
1197154285 X:123253216-123253238 TAGAAATACAATGTACAATTAGG - Intronic
1197555768 X:127950841-127950863 TAGACAGACAAAACACAAGGTGG - Intergenic
1199165169 X:144664072-144664094 TAGAAATACAACAAACTAAGTGG - Intergenic
1200170448 X:154069674-154069696 TAAAAATACAAAAAACAAGCTGG + Intronic
1200449954 Y:3313885-3313907 TAGAAAAACATCAAACAAATTGG - Intergenic
1200806388 Y:7437657-7437679 TAAAAATACAAAAAACAAGCTGG - Intergenic
1201888334 Y:18912454-18912476 TTGAAATACAACAAAATAGTTGG - Intergenic