ID: 1021450191

View in Genome Browser
Species Human (GRCh38)
Location 7:20777652-20777674
Sequence ATAAATCTTGCCACCTATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021450185_1021450191 21 Left 1021450185 7:20777608-20777630 CCTTCACTCGTCGAGTCTGCCAA No data
Right 1021450191 7:20777652-20777674 ATAAATCTTGCCACCTATGGAGG No data
1021450186_1021450191 2 Left 1021450186 7:20777627-20777649 CCAACCCCATGATAAAATGACAA No data
Right 1021450191 7:20777652-20777674 ATAAATCTTGCCACCTATGGAGG No data
1021450189_1021450191 -4 Left 1021450189 7:20777633-20777655 CCATGATAAAATGACAAGAATAA No data
Right 1021450191 7:20777652-20777674 ATAAATCTTGCCACCTATGGAGG No data
1021450187_1021450191 -2 Left 1021450187 7:20777631-20777653 CCCCATGATAAAATGACAAGAAT No data
Right 1021450191 7:20777652-20777674 ATAAATCTTGCCACCTATGGAGG No data
1021450188_1021450191 -3 Left 1021450188 7:20777632-20777654 CCCATGATAAAATGACAAGAATA No data
Right 1021450191 7:20777652-20777674 ATAAATCTTGCCACCTATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021450191 Original CRISPR ATAAATCTTGCCACCTATGG AGG Intergenic
No off target data available for this crispr