ID: 1021450332

View in Genome Browser
Species Human (GRCh38)
Location 7:20778262-20778284
Sequence CGCAGCCCGAGGGGAGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021450320_1021450332 17 Left 1021450320 7:20778222-20778244 CCTTTGTGTGCGGTGGGCGCGGC No data
Right 1021450332 7:20778262-20778284 CGCAGCCCGAGGGGAGCGGCGGG No data
1021450316_1021450332 25 Left 1021450316 7:20778214-20778236 CCGCGGTGCCTTTGTGTGCGGTG No data
Right 1021450332 7:20778262-20778284 CGCAGCCCGAGGGGAGCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021450332 Original CRISPR CGCAGCCCGAGGGGAGCGGC GGG Intergenic