ID: 1021451053

View in Genome Browser
Species Human (GRCh38)
Location 7:20784429-20784451
Sequence CACAGTGGCGGCGGCGGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3797
Summary {0: 1, 1: 6, 2: 87, 3: 708, 4: 2995}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021451053_1021451059 -1 Left 1021451053 7:20784429-20784451 CCGCCGCCGCCGCCGCCACTGTG 0: 1
1: 6
2: 87
3: 708
4: 2995
Right 1021451059 7:20784451-20784473 GCGTCTTCACGTGCTTGCTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
1021451053_1021451060 2 Left 1021451053 7:20784429-20784451 CCGCCGCCGCCGCCGCCACTGTG 0: 1
1: 6
2: 87
3: 708
4: 2995
Right 1021451060 7:20784454-20784476 TCTTCACGTGCTTGCTGAGGTGG 0: 1
1: 0
2: 0
3: 10
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021451053 Original CRISPR CACAGTGGCGGCGGCGGCGG CGG (reversed) Exonic