ID: 1021451059

View in Genome Browser
Species Human (GRCh38)
Location 7:20784451-20784473
Sequence GCGTCTTCACGTGCTTGCTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 63}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021451053_1021451059 -1 Left 1021451053 7:20784429-20784451 CCGCCGCCGCCGCCGCCACTGTG 0: 1
1: 6
2: 87
3: 708
4: 2995
Right 1021451059 7:20784451-20784473 GCGTCTTCACGTGCTTGCTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
1021451050_1021451059 10 Left 1021451050 7:20784418-20784440 CCGCCGAGCCGCCGCCGCCGCCG 0: 3
1: 26
2: 112
3: 524
4: 1289
Right 1021451059 7:20784451-20784473 GCGTCTTCACGTGCTTGCTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
1021451056_1021451059 -10 Left 1021451056 7:20784438-20784460 CCGCCGCCACTGTGCGTCTTCAC 0: 1
1: 0
2: 1
3: 6
4: 77
Right 1021451059 7:20784451-20784473 GCGTCTTCACGTGCTTGCTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
1021451049_1021451059 11 Left 1021451049 7:20784417-20784439 CCCGCCGAGCCGCCGCCGCCGCC 0: 3
1: 15
2: 118
3: 421
4: 2681
Right 1021451059 7:20784451-20784473 GCGTCTTCACGTGCTTGCTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
1021451051_1021451059 7 Left 1021451051 7:20784421-20784443 CCGAGCCGCCGCCGCCGCCGCCG 0: 23
1: 168
2: 330
3: 758
4: 1941
Right 1021451059 7:20784451-20784473 GCGTCTTCACGTGCTTGCTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
1021451055_1021451059 -7 Left 1021451055 7:20784435-20784457 CCGCCGCCGCCACTGTGCGTCTT 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1021451059 7:20784451-20784473 GCGTCTTCACGTGCTTGCTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
1021451054_1021451059 -4 Left 1021451054 7:20784432-20784454 CCGCCGCCGCCGCCACTGTGCGT 0: 1
1: 0
2: 7
3: 42
4: 357
Right 1021451059 7:20784451-20784473 GCGTCTTCACGTGCTTGCTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
1021451046_1021451059 23 Left 1021451046 7:20784405-20784427 CCGCTGCCCGAGCCCGCCGAGCC 0: 1
1: 0
2: 3
3: 26
4: 274
Right 1021451059 7:20784451-20784473 GCGTCTTCACGTGCTTGCTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
1021451052_1021451059 2 Left 1021451052 7:20784426-20784448 CCGCCGCCGCCGCCGCCGCCACT 0: 17
1: 224
2: 1709
3: 2660
4: 4886
Right 1021451059 7:20784451-20784473 GCGTCTTCACGTGCTTGCTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
1021451045_1021451059 26 Left 1021451045 7:20784402-20784424 CCGCCGCTGCCCGAGCCCGCCGA 0: 1
1: 0
2: 0
3: 24
4: 192
Right 1021451059 7:20784451-20784473 GCGTCTTCACGTGCTTGCTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
1021451048_1021451059 16 Left 1021451048 7:20784412-20784434 CCGAGCCCGCCGAGCCGCCGCCG 0: 1
1: 0
2: 6
3: 37
4: 392
Right 1021451059 7:20784451-20784473 GCGTCTTCACGTGCTTGCTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
1021451047_1021451059 17 Left 1021451047 7:20784411-20784433 CCCGAGCCCGCCGAGCCGCCGCC 0: 1
1: 1
2: 7
3: 62
4: 415
Right 1021451059 7:20784451-20784473 GCGTCTTCACGTGCTTGCTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021451059 Original CRISPR GCGTCTTCACGTGCTTGCTG AGG Exonic