ID: 1021451059

View in Genome Browser
Species Human (GRCh38)
Location 7:20784451-20784473
Sequence GCGTCTTCACGTGCTTGCTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 63}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021451054_1021451059 -4 Left 1021451054 7:20784432-20784454 CCGCCGCCGCCGCCACTGTGCGT 0: 1
1: 0
2: 7
3: 42
4: 357
Right 1021451059 7:20784451-20784473 GCGTCTTCACGTGCTTGCTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
1021451055_1021451059 -7 Left 1021451055 7:20784435-20784457 CCGCCGCCGCCACTGTGCGTCTT 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1021451059 7:20784451-20784473 GCGTCTTCACGTGCTTGCTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
1021451046_1021451059 23 Left 1021451046 7:20784405-20784427 CCGCTGCCCGAGCCCGCCGAGCC 0: 1
1: 0
2: 3
3: 26
4: 274
Right 1021451059 7:20784451-20784473 GCGTCTTCACGTGCTTGCTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
1021451053_1021451059 -1 Left 1021451053 7:20784429-20784451 CCGCCGCCGCCGCCGCCACTGTG 0: 1
1: 6
2: 87
3: 708
4: 2995
Right 1021451059 7:20784451-20784473 GCGTCTTCACGTGCTTGCTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
1021451047_1021451059 17 Left 1021451047 7:20784411-20784433 CCCGAGCCCGCCGAGCCGCCGCC 0: 1
1: 1
2: 7
3: 62
4: 415
Right 1021451059 7:20784451-20784473 GCGTCTTCACGTGCTTGCTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
1021451051_1021451059 7 Left 1021451051 7:20784421-20784443 CCGAGCCGCCGCCGCCGCCGCCG 0: 23
1: 168
2: 330
3: 758
4: 1941
Right 1021451059 7:20784451-20784473 GCGTCTTCACGTGCTTGCTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
1021451056_1021451059 -10 Left 1021451056 7:20784438-20784460 CCGCCGCCACTGTGCGTCTTCAC 0: 1
1: 0
2: 1
3: 6
4: 77
Right 1021451059 7:20784451-20784473 GCGTCTTCACGTGCTTGCTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
1021451048_1021451059 16 Left 1021451048 7:20784412-20784434 CCGAGCCCGCCGAGCCGCCGCCG 0: 1
1: 0
2: 6
3: 37
4: 392
Right 1021451059 7:20784451-20784473 GCGTCTTCACGTGCTTGCTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
1021451045_1021451059 26 Left 1021451045 7:20784402-20784424 CCGCCGCTGCCCGAGCCCGCCGA 0: 1
1: 0
2: 0
3: 24
4: 192
Right 1021451059 7:20784451-20784473 GCGTCTTCACGTGCTTGCTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
1021451050_1021451059 10 Left 1021451050 7:20784418-20784440 CCGCCGAGCCGCCGCCGCCGCCG 0: 3
1: 26
2: 112
3: 524
4: 1289
Right 1021451059 7:20784451-20784473 GCGTCTTCACGTGCTTGCTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
1021451049_1021451059 11 Left 1021451049 7:20784417-20784439 CCCGCCGAGCCGCCGCCGCCGCC 0: 3
1: 15
2: 118
3: 421
4: 2681
Right 1021451059 7:20784451-20784473 GCGTCTTCACGTGCTTGCTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
1021451052_1021451059 2 Left 1021451052 7:20784426-20784448 CCGCCGCCGCCGCCGCCGCCACT 0: 17
1: 224
2: 1709
3: 2660
4: 4886
Right 1021451059 7:20784451-20784473 GCGTCTTCACGTGCTTGCTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021451059 Original CRISPR GCGTCTTCACGTGCTTGCTG AGG Exonic
904044254 1:27600727-27600749 GGGTCTCCACCTGATTGCTGTGG - Intronic
904533605 1:31184535-31184557 GCAACTTCATGTGGTTGCTGAGG - Intronic
906250085 1:44304533-44304555 GCCTAGTGACGTGCTTGCTGCGG - Intronic
907308101 1:53524809-53524831 GGGCCTTGACGTGCTTGCGGAGG + Exonic
922800243 1:228361796-228361818 GTGTCTTCAAGCCCTTGCTGAGG - Intronic
1063547909 10:7000148-7000170 GAATCTTCACTTGCTTTCTGAGG + Intergenic
1075710245 10:124526896-124526918 CCTTCTTCCCCTGCTTGCTGCGG - Intronic
1076497393 10:130905908-130905930 GCGTCACCACGAGCCTGCTGTGG - Intergenic
1082095540 11:48126580-48126602 GGGTCTTCACGTGGTTGAAGGGG + Intronic
1085318974 11:75562809-75562831 GCCTCCTCACAGGCTTGCTGAGG + Exonic
1086349878 11:85934862-85934884 GCGTCTTCACGTACTGGGTGGGG - Intergenic
1091387635 12:104953-104975 GCGGCCTCACGTGCCTGCTCCGG + Intronic
1091755696 12:3050013-3050035 GTTTCTTCAATTGCTTGCTGGGG + Intergenic
1096808894 12:54157365-54157387 GTTTCTTCATGTGCGTGCTGGGG - Intergenic
1107365163 13:39664205-39664227 GTGTCTTCAGGTGTTTGCTCTGG + Intronic
1108060252 13:46526050-46526072 GCACCTGCACCTGCTTGCTGAGG + Intergenic
1123140656 14:106074152-106074174 CCGTCTTCACATGCTGGCAGGGG - Intergenic
1123918737 15:25055915-25055937 GCGCCCTCACGTGCTGGTTGTGG + Intergenic
1126113052 15:45186912-45186934 CCGTCTTCACCTCCTTTCTGGGG + Intronic
1133278479 16:4651983-4652005 GCGTCTTCACGGGCTCGTGGGGG - Exonic
1142994608 17:3753255-3753277 CCATCTTCATGAGCTTGCTGAGG - Intronic
1152026807 17:77815279-77815301 GCGTCTACACCTGCTGTCTGGGG - Intergenic
1155515666 18:26621844-26621866 TGGTCCTCACGTGCTTTCTGTGG + Intronic
1159912802 18:74162308-74162330 GCATCATCACCTGCTTTCTGCGG - Intergenic
1160539756 18:79614158-79614180 GCGTCTCCACGTGCTGGGAGTGG + Intergenic
1162339873 19:10086077-10086099 GCGTCTTCACGTCCCTCGTGGGG - Intergenic
942278158 2:174337303-174337325 GCGTCTTAATGTGTTTGCTCAGG - Exonic
942316120 2:174697800-174697822 GAGCCTACAGGTGCTTGCTGGGG + Intergenic
1174653841 20:52153015-52153037 ACTTCTTCATGTGCTTGCTCAGG + Exonic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1180197132 21:46203868-46203890 GTGTGTTCTGGTGCTTGCTGTGG - Intronic
1180876686 22:19178181-19178203 GCGTCTTCACGTACTCGGTGGGG + Exonic
1184832355 22:46996744-46996766 GCCTCTTCATGTTCCTGCTGTGG + Intronic
950834409 3:15905488-15905510 GCCTCTTAATGTCCTTGCTGTGG - Intergenic
959068090 3:101677826-101677848 GCGTCTCCCAGTGCGTGCTGAGG + Intergenic
961323697 3:126097046-126097068 TAGCCTTCACGTGCTTGCTCGGG - Intronic
965499329 3:169438709-169438731 ATTTCTTCACGTGCTGGCTGTGG - Intronic
980585689 4:134812070-134812092 GCGAGTTCACGTGAGTGCTGTGG + Intergenic
985527851 5:416088-416110 GCACCTTCACGTGGATGCTGGGG - Intronic
985787944 5:1909661-1909683 GAGGCTTAACGTGCTTGCTGGGG - Intergenic
986237718 5:5927468-5927490 GCATCTCCAAGTGCTTCCTGCGG - Intergenic
987141380 5:14950430-14950452 GTGTCTTCACATGGTTGCAGGGG + Intergenic
1001713663 5:173797593-173797615 CCGACTCCACGTTCTTGCTGAGG + Intergenic
1002409306 5:179061267-179061289 GCCTCTTCCCTTGCTTTCTGTGG + Intronic
1021451059 7:20784451-20784473 GCGTCTTCACGTGCTTGCTGAGG + Exonic
1025713405 7:63931689-63931711 GCGGGTTCATGGGCTTGCTGGGG - Intergenic
1033050881 7:138002980-138003002 TGGTATTCACGTGATTGCTGGGG + Intronic
1045651451 8:104345231-104345253 GAGTCTTAAGGTGCTTGCTAAGG + Intronic
1055945822 9:81689853-81689875 GCGTCCTCCCGGGCTTGGTGAGG + Intergenic
1058312530 9:103522079-103522101 ACCTCTTAACTTGCTTGCTGAGG - Intergenic
1058937114 9:109779943-109779965 GCGTGGACACGCGCTTGCTGGGG - Intronic
1060175435 9:121494175-121494197 GGGTGTGCACGTGCTTCCTGGGG - Intergenic
1062103015 9:134738196-134738218 GCGTCTTCAGGTGCTTCTCGTGG + Intronic
1186515971 X:10166375-10166397 GCTGCTGCACGTGCTTGCTAGGG - Intronic
1187843641 X:23514322-23514344 GCTTCTCCATCTGCTTGCTGTGG - Intergenic
1199660784 X:150048436-150048458 CCGTCTTAACATGCTTGCTTGGG - Intergenic
1200041125 X:153370289-153370311 CCGTCTACACTTGCTTTCTGGGG + Intergenic