ID: 1021456536

View in Genome Browser
Species Human (GRCh38)
Location 7:20835340-20835362
Sequence AGAAGTTCGCGCGTTTGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021456536_1021456541 20 Left 1021456536 7:20835340-20835362 CCGCTGCAAACGCGCGAACTTCT No data
Right 1021456541 7:20835383-20835405 ACTCCTCCCAGTGCACTGGCCGG No data
1021456536_1021456540 16 Left 1021456536 7:20835340-20835362 CCGCTGCAAACGCGCGAACTTCT No data
Right 1021456540 7:20835379-20835401 GCGCACTCCTCCCAGTGCACTGG No data
1021456536_1021456543 24 Left 1021456536 7:20835340-20835362 CCGCTGCAAACGCGCGAACTTCT No data
Right 1021456543 7:20835387-20835409 CTCCCAGTGCACTGGCCGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021456536 Original CRISPR AGAAGTTCGCGCGTTTGCAG CGG (reversed) Intergenic
No off target data available for this crispr