ID: 1021456765

View in Genome Browser
Species Human (GRCh38)
Location 7:20837931-20837953
Sequence AATTAAAAGCAGATGCTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021456762_1021456765 23 Left 1021456762 7:20837885-20837907 CCTTCCTATAAAATTTAGTCGTG No data
Right 1021456765 7:20837931-20837953 AATTAAAAGCAGATGCTGGACGG No data
1021456763_1021456765 19 Left 1021456763 7:20837889-20837911 CCTATAAAATTTAGTCGTGACAA No data
Right 1021456765 7:20837931-20837953 AATTAAAAGCAGATGCTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021456765 Original CRISPR AATTAAAAGCAGATGCTGGA CGG Intergenic
No off target data available for this crispr