ID: 1021459774

View in Genome Browser
Species Human (GRCh38)
Location 7:20873038-20873060
Sequence TCAAGTTCCCAGATGATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021459772_1021459774 -2 Left 1021459772 7:20873017-20873039 CCAGAAGAATTTGCATTTCTGTC No data
Right 1021459774 7:20873038-20873060 TCAAGTTCCCAGATGATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021459774 Original CRISPR TCAAGTTCCCAGATGATGCA GGG Intergenic
No off target data available for this crispr