ID: 1021464623

View in Genome Browser
Species Human (GRCh38)
Location 7:20928208-20928230
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021464623_1021464625 12 Left 1021464623 7:20928208-20928230 CCAGTGGCAGCAAACAAAGCTGC No data
Right 1021464625 7:20928243-20928265 CTATGCCAATCAGAAGCTGATGG No data
1021464623_1021464627 25 Left 1021464623 7:20928208-20928230 CCAGTGGCAGCAAACAAAGCTGC No data
Right 1021464627 7:20928256-20928278 AAGCTGATGGAAGCAGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021464623 Original CRISPR GCAGCTTTGTTTGCTGCCAC TGG (reversed) Intergenic
No off target data available for this crispr