ID: 1021464625

View in Genome Browser
Species Human (GRCh38)
Location 7:20928243-20928265
Sequence CTATGCCAATCAGAAGCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021464623_1021464625 12 Left 1021464623 7:20928208-20928230 CCAGTGGCAGCAAACAAAGCTGC No data
Right 1021464625 7:20928243-20928265 CTATGCCAATCAGAAGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021464625 Original CRISPR CTATGCCAATCAGAAGCTGA TGG Intergenic
No off target data available for this crispr