ID: 1021472764

View in Genome Browser
Species Human (GRCh38)
Location 7:21024473-21024495
Sequence CCCTGCCATAACCAATACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021472754_1021472764 20 Left 1021472754 7:21024430-21024452 CCTCAGACTCCCTGCCCGAGCCT No data
Right 1021472764 7:21024473-21024495 CCCTGCCATAACCAATACACAGG No data
1021472757_1021472764 10 Left 1021472757 7:21024440-21024462 CCTGCCCGAGCCTAGGAGAAGCA No data
Right 1021472764 7:21024473-21024495 CCCTGCCATAACCAATACACAGG No data
1021472758_1021472764 6 Left 1021472758 7:21024444-21024466 CCCGAGCCTAGGAGAAGCAGTGT No data
Right 1021472764 7:21024473-21024495 CCCTGCCATAACCAATACACAGG No data
1021472760_1021472764 0 Left 1021472760 7:21024450-21024472 CCTAGGAGAAGCAGTGTCCCAAA No data
Right 1021472764 7:21024473-21024495 CCCTGCCATAACCAATACACAGG No data
1021472756_1021472764 11 Left 1021472756 7:21024439-21024461 CCCTGCCCGAGCCTAGGAGAAGC No data
Right 1021472764 7:21024473-21024495 CCCTGCCATAACCAATACACAGG No data
1021472759_1021472764 5 Left 1021472759 7:21024445-21024467 CCGAGCCTAGGAGAAGCAGTGTC No data
Right 1021472764 7:21024473-21024495 CCCTGCCATAACCAATACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021472764 Original CRISPR CCCTGCCATAACCAATACAC AGG Intergenic
No off target data available for this crispr