ID: 1021479775

View in Genome Browser
Species Human (GRCh38)
Location 7:21103393-21103415
Sequence TTCTCAGAACTGTTAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021479773_1021479775 -10 Left 1021479773 7:21103380-21103402 CCTTGGCTAATCCTTCTCAGAAC No data
Right 1021479775 7:21103393-21103415 TTCTCAGAACTGTTAAAAGCAGG No data
1021479770_1021479775 10 Left 1021479770 7:21103360-21103382 CCCGGTGCTTTACAATCACTCCT No data
Right 1021479775 7:21103393-21103415 TTCTCAGAACTGTTAAAAGCAGG No data
1021479771_1021479775 9 Left 1021479771 7:21103361-21103383 CCGGTGCTTTACAATCACTCCTT No data
Right 1021479775 7:21103393-21103415 TTCTCAGAACTGTTAAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021479775 Original CRISPR TTCTCAGAACTGTTAAAAGC AGG Intergenic
No off target data available for this crispr