ID: 1021480600

View in Genome Browser
Species Human (GRCh38)
Location 7:21111408-21111430
Sequence CCAATGTAGGCCCTTACCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021480592_1021480600 23 Left 1021480592 7:21111362-21111384 CCTGACTTTCCTAAGTGTTTTGG No data
Right 1021480600 7:21111408-21111430 CCAATGTAGGCCCTTACCTCTGG No data
1021480595_1021480600 14 Left 1021480595 7:21111371-21111393 CCTAAGTGTTTTGGGAACCACAC No data
Right 1021480600 7:21111408-21111430 CCAATGTAGGCCCTTACCTCTGG No data
1021480596_1021480600 -3 Left 1021480596 7:21111388-21111410 CCACACTGTGATCTGAACTCCCA No data
Right 1021480600 7:21111408-21111430 CCAATGTAGGCCCTTACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021480600 Original CRISPR CCAATGTAGGCCCTTACCTC TGG Intergenic
No off target data available for this crispr