ID: 1021488651

View in Genome Browser
Species Human (GRCh38)
Location 7:21194216-21194238
Sequence CAATGTCCCCAAAGCTTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021488651_1021488653 -9 Left 1021488651 7:21194216-21194238 CCAACTAAGCTTTGGGGACATTG No data
Right 1021488653 7:21194230-21194252 GGGACATTGAAAAAAATTCAGGG No data
1021488651_1021488652 -10 Left 1021488651 7:21194216-21194238 CCAACTAAGCTTTGGGGACATTG No data
Right 1021488652 7:21194229-21194251 GGGGACATTGAAAAAAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021488651 Original CRISPR CAATGTCCCCAAAGCTTAGT TGG (reversed) Intergenic
No off target data available for this crispr